We have located links that may give you full text access.
Complemented Palindromic Small RNAs First Discovered from SARS Coronavirus.
Genes 2018 September 6
In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.
Full text links
Related Resources
Trending Papers
Heart failure with preserved ejection fraction: diagnosis, risk assessment, and treatment.Clinical Research in Cardiology : Official Journal of the German Cardiac Society 2024 April 12
Proximal versus distal diuretics in congestive heart failure.Nephrology, Dialysis, Transplantation 2024 Februrary 30
World Health Organization and International Consensus Classification of eosinophilic disorders: 2024 update on diagnosis, risk stratification, and management.American Journal of Hematology 2024 March 30
Efficacy and safety of pharmacotherapy in chronic insomnia: A review of clinical guidelines and case reports.Mental Health Clinician 2023 October
Get seemless 1-tap access through your institution/university
For the best experience, use the Read mobile app
All material on this website is protected by copyright, Copyright © 1994-2024 by WebMD LLC.
This website also contains material copyrighted by 3rd parties.
By using this service, you agree to our terms of use and privacy policy.
Your Privacy Choices
You can now claim free CME credits for this literature searchClaim now
Get seemless 1-tap access through your institution/university
For the best experience, use the Read mobile app