We have located links that may give you full text access.
[Analysis of NF2 gene mutations in intraspinal Schwannomas].
Zhonghua Yi Xue Yi Chuan Xue za Zhi = Zhonghua Yixue Yichuanxue Zazhi = Chinese Journal of Medical Genetics 2017 October 11
OBJECTIVE: To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.
METHODS: Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
RESULTS: Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.
CONCLUSION: The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.
METHODS: Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.
RESULTS: Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.
CONCLUSION: The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.
Full text links
Related Resources
Trending Papers
Challenges in Septic Shock: From New Hemodynamics to Blood Purification Therapies.Journal of Personalized Medicine 2024 Februrary 4
Molecular Targets of Novel Therapeutics for Diabetic Kidney Disease: A New Era of Nephroprotection.International Journal of Molecular Sciences 2024 April 4
The 'Ten Commandments' for the 2023 European Society of Cardiology guidelines for the management of endocarditis.European Heart Journal 2024 April 18
A Guide to the Use of Vasopressors and Inotropes for Patients in Shock.Journal of Intensive Care Medicine 2024 April 14
Diagnosis and Management of Cardiac Sarcoidosis: A Scientific Statement From the American Heart Association.Circulation 2024 April 19
Essential thrombocythaemia: A contemporary approach with new drugs on the horizon.British Journal of Haematology 2024 April 9
Get seemless 1-tap access through your institution/university
For the best experience, use the Read mobile app
All material on this website is protected by copyright, Copyright © 1994-2024 by WebMD LLC.
This website also contains material copyrighted by 3rd parties.
By using this service, you agree to our terms of use and privacy policy.
Your Privacy Choices
You can now claim free CME credits for this literature searchClaim now
Get seemless 1-tap access through your institution/university
For the best experience, use the Read mobile app