Add like
Add dislike
Add to saved papers

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin β6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin β6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin β6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin β6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin β6.

Full text links

We have located links that may give you full text access.
Can't access the paper?
Try logging in through your university/institutional subscription. For a smoother one-click institutional access experience, please use our mobile app.

For the best experience, use the Read mobile app

Mobile app image

Get seemless 1-tap access through your institution/university

For the best experience, use the Read mobile app

All material on this website is protected by copyright, Copyright © 1994-2024 by WebMD LLC.
This website also contains material copyrighted by 3rd parties.

By using this service, you agree to our terms of use and privacy policy.

Your Privacy Choices Toggle icon

You can now claim free CME credits for this literature searchClaim now

Get seemless 1-tap access through your institution/university

For the best experience, use the Read mobile app