keyword
MENU ▼
Read by QxMD icon Read
search

imperfecta osteogenesis

keyword
https://www.readbyqxmd.com/read/29225276/mitral-regurgitation-and-heart-failure-as-the-first-presentation-in-a-patient-with-features-of-two-connective-tissue-disorders-a-rare-combination-of-mucopolysaccharidosis-and-osteogenesis-imperfecta
#1
Yasuhiro Hamatani, Junko Nakashima, Keiko Ohta-Ogo, Makoto Amaki, Masashi Koga, Daisetsu Aoyama, Kyohei Marume, Kenichiro Sawada, Yasuteru Nakashima, Atsushi Shibata, Atsushi Okada, Hiroyuki Takahama, Takuya Hasegawa, Yasuo Sugano, Hideaki Kanzaki, Yoshihiko Ikeda, Satoshi Yasuda, Hatsue Ishibashi-Ueda, Toshihisa Anzai
Connective tissue disorders sometimes involve cardiovascular systems. This report describes the case of a middle-aged man with mitral regurgitation and heart failure. He had distinctive features of mucopolysaccharidosis (MPS) type III, but no gene mutations that were known to be associated with MPS. Meanwhile, he had a COL1A2 gene mutation that is associated with osteogenesis imperfecta (OI), and had some features that were compatible with OI. The patient might have had a rare connective tissue disorder with the characteristics of MPS type III and OI, which was initially detected as a result of the cardiovascular manifestations...
December 8, 2017: Internal Medicine
https://www.readbyqxmd.com/read/29216697/-case-report-total-hip-replacement-in-osteogenesis-imperfecta
#2
T Ferrer-Catasús, A León-García, M Tey-Pons, A L Arenas-Díaz, F Marqués-López
We study, apropos of a case, a total hip arthroplasty in a patient with osteogenesis imperfecta. The characteristics of this disease, such as high risk of fracture and the presence of deformities, make this surgery a challenge for the orthopedic surgeon. In this manuscript, we review for the first time in this indication the preoperative planning and the selection of implants, with special emphasis on measures for the prevention of complications.
July 2017: Acta Ortopédica Mexicana
https://www.readbyqxmd.com/read/29207224/-bone-biopsy-in-the-chronic-kidney-disease-ckd
#3
REVIEW
Luca Dalle Carbonare, Maria Teresa Valenti
Histomorphometry or quantitative histology is the analysis on histologic sections of bone resorption, formation and structure parameters. It is the only technique allowing a dynamic evaluation of osteoblast activity after labelling with tetracycline. In addition, the use of computed image analyzer allows the possibility to assess bone microarchitecture. Histomorphometric bone biopsy is a reliable and well-tolerated procedure. Bone samples are taken at iliac crest level under local anesthesia and sedation. Samples are put into methyl-metacrilate resin where the sections are prepared for the microscopic analysis of different histomorphometric parameters...
December 5, 2017: Giornale Italiano di Nefrologia: Organo Ufficiale Della Società Italiana di Nefrologia
https://www.readbyqxmd.com/read/29189536/incidence-of-fractures-from-perioperative-blood-pressure-cuff-use-tourniquet-use-and-patient-positioning-in-osteogenesis-imperfecta
#4
Brian T Sullivan, Adam Margalit, Vaibhav S Garg, Dolores B Njoku, Paul D Sponseller
BACKGROUND: Osteogenesis imperfecta (OI) is a rare connective tissue disease with varying severity. Patients with OI are highly susceptible to skeletal fractures. Optimal perioperative management of these patients is not well defined. We investigated the risks associated with intraoperative use of noninvasive blood pressure (NIBP) cuffs, tourniquets, and intra-arterial catheters, and patient positioning in children with OI. METHODS: We retrospectively reviewed records of patients younger than 21 years with OI who underwent surgery with general anesthesia from 2010 to 2016 at our tertiary care center...
November 16, 2017: Journal of Pediatric Orthopedics
https://www.readbyqxmd.com/read/29188603/-genetic-mutation-and-clinical-features-of-osteogenesis-imperfecta-type-v
#5
Shizhen Guan, Xue Bai, Yi Wang, Zhigang Liu, Xiuzhi Ren, Tianke Zhang, Mingyan Ju, Keqiu Li, Guang Li
OBJECTIVE: To explore genetic mutations and clinical features of osteogenesis imperfecta type V. METHODS: Clinical record of five patients (including one familial case) with osteogenesis imperfecta type V were retrospectively analyzed. Peripheral blood samples of the patients, one family member, as well as healthy controls were collected. Mutation of IFITM5 gene was identified by PCR amplification and Sanger sequencing. RESULTS: A heterozygous mutation (c...
December 10, 2017: Zhonghua Yi Xue Yi Chuan Xue za Zhi, Zhonghua Yixue Yichuanxue Zazhi, Chinese Journal of Medical Genetics
https://www.readbyqxmd.com/read/29187770/classification-of-micro-ct-images-using-3d-characterization-of-bone-canal-patterns-in-human-osteogenesis-imperfecta
#6
Anas Z Abidin, John Jameson, Robert Molthen, Axel Wismüller
Few studies have analyzed the microstructural properties of bone in cases of Osteogenenis Imperfecta (OI), or 'brittle bone disease'. Current approaches mainly focus on bone mineral density measurements as an indirect indicator of bone strength and quality. It has been shown that bone strength would depend not only on composition but also structural organization. This study aims to characterize 3D structure of the cortical bone in high-resolution micro CT images. A total of 40 bone fragments from 28 subjects (13 with OI and 15 healthy controls) were imaged using micro tomography using a synchrotron light source (SRμCT)...
March 2017: Proceedings of SPIE
https://www.readbyqxmd.com/read/29186693/osteocyte-intrinsic-tgf-%C3%AE-signaling-regulates-bone-quality-through-perilacunar-canalicular-remodeling
#7
Neha S Dole, Courtney M Mazur, Claire Acevedo, Justin P Lopez, David A Monteiro, Tristan W Fowler, Bernd Gludovatz, Flynn Walsh, Jenna N Regan, Sara Messina, Daniel S Evans, Thomas F Lang, Bin Zhang, Robert O Ritchie, Khalid S Mohammad, Tamara Alliston
Poor bone quality contributes to bone fragility in diabetes, aging, and osteogenesis imperfecta. However, the mechanisms controlling bone quality are not well understood, contributing to the current lack of strategies to diagnose or treat bone quality deficits. Transforming growth factor beta (TGF-β) signaling is a crucial mechanism known to regulate the material quality of bone, but its cellular target in this regulation is unknown. Studies showing that osteocytes directly remodel their perilacunar/canalicular matrix led us to hypothesize that TGF-β controls bone quality through perilacunar/canalicular remodeling (PLR)...
November 28, 2017: Cell Reports
https://www.readbyqxmd.com/read/29182597/-epidemiology-of-imperfect-osteogenesis-a-rare-disease-in-the-valencia-region
#8
Silvia Gimeno-Martos, Carlos Pérez-Riera, Sandra Guardiola-Vilarroig, Clara Cavero-Carbonell
OBJECTIVE: Osteogenesis imperfecta (OI) is a rare connective tissue and bone disease that results in a bone fragility of varying severity. The objective was to determine and describe the OI in the Valencia Region (VR) during the period 2004 to 2014. METHODS: From the Rare Diseases Information System of the VR (SIER-CV) patients from 2004 to 2014 with the codes of the International Classification of Diseases for the OI were identified: 756.51 from the 9th Revision-Clinical Modification and Q78...
November 28, 2017: Revista Española de Salud Pública
https://www.readbyqxmd.com/read/29178448/expanding-the-clinical-spectrum-of-phenotypes-caused-by-pathogenic-variants-in-plod2
#9
Gabriela Ferraz Leal, Gen Nishimura, Ulrika Voss, Débora Romeo Bertola, Eva Åström, Johan Svensson, Guilherme Lopes Yamamoto, Anna Hammarsjö, Eva Horemuzova, Nikos Papadiogannakis, Erik Iwarsson, Giedre Grigelioniene, Emma Tham
Osteogenesis imperfecta (OI) is a strikingly heterogeneous group of disorders with a broad range of phenotypic variations. It is also one of the differential diagnoses in bent bone dysplasias along with campomelic dysplasia and thanatophoric dysplasia and can usually be distinguished by decreased bone mineralization and bone fractures. Bent bone dyplasias also include syndromes such as kyphomelic dysplasia [MIM:211350] and mesomelic dysplasia Kozlowski-Reardon [MIM249710], both of which have been under debate regarding whether or not they are a real entity or simply a phenotypic manifestation of another dysplasia including OI...
November 27, 2017: Journal of Bone and Mineral Research: the Official Journal of the American Society for Bone and Mineral Research
https://www.readbyqxmd.com/read/29177700/novel-mutations-in-plod2-cause-rare-bruck-syndrome
#10
Fang Lv, Xiaojie Xu, Yuwen Song, Lujiao Li, Asan, Jian Wang, Huanming Yang, Ou Wang, Yan Jiang, Weibo Xia, Xiaoping Xing, Mei Li
Bruck syndrome is a rare autosomal recessive form of osteogenesis imperfecta (OI), which is mainly characterized by joint contractures and recurrent fragility fractures. Mutations in FKBP10 and PLOD2 were identified as the underlying genetic defects of Bruck syndrome. Here we investigated the phenotypes and the pathogenic mutations of three unrelated Chinese patients with Bruck syndrome. Clinical fractures, bone mineral density (BMD), bone turnover biomarkers, and skeletal images were evaluated in detail. The pathogenic mutations were identified by targeted next-generation sequencing and subsequently confirmed by Sanger sequencing and cosegregation analysis...
November 24, 2017: Calcified Tissue International
https://www.readbyqxmd.com/read/29174564/crispr-cas9-engineered-osteogenesis-imperfecta-type-v-leads-to-severe-skeletal-deformities-and-perinatal-lethality-in-mice
#11
Frank Rauch, Yeqing Geng, Lisa Lamplugh, Bahareh Hekmatnejad, Marie-Hélène Gaumond, Janice Penney, Yojiro Yamanaka, Pierre Moffatt
Osteogenesis imperfecta (OI) type V is caused by an autosomal dominant mutation in the IFITM5 gene, also known as BRIL. The c.-14C>T mutation in the 5'UTR of BRIL creates a novel translational start site adding 5 residues (MALEP) in frame with the natural coding of BRIL. A neomorphic function has been proposed for the MALEP-BRIL but the mechanisms at play are still unknown. In order to further understand the effects of MALEP-BRIL in vivo, we generated a knockin (KI) mouse model having the exact genetic -14C>T replica of patients with OI type V...
November 22, 2017: Bone
https://www.readbyqxmd.com/read/29165672/trans-sylvian-approach-to-microvascular-decompression-for-trigeminal-neuralgia-in-syndromic-cranial-base-settling
#12
Mrityunjoy Sarkar, Ashok Pillai
BACKGROUND AND IMPORTANCE: The lateral suboccipital approach for microvascular decompression (MVD) of the trigeminal nerve has become a standard-of-care over the past several decades. Syndromic cranial base settling, a rare but known cause for trigeminal neuralgia (TN), poses significant dilemmas in clinical management. In such cases, distorted anatomy may render surgery via the suboccipital approach difficult or even impossible. CLINICAL PRESENTATION: A 34-yr-old male with osteogenesis imperfecta and severe basilar invagination suffered from TN that was refractory to medication and stereotactic radiosurgery...
November 18, 2017: Operative Neurosurgery (Hagerstown, Md.)
https://www.readbyqxmd.com/read/29158687/novel-mutation-of-fkbp10-in-a-pediatric-patient-with-osteogenesis-imperfecta-type-xi-identified-by-clinical-exome-sequencing
#13
Harvy Mauricio Velasco, Jessica L Morales
Osteogenesis imperfecta (OI) is a hereditary disease characterized by bone fragility caused by mutations in the proteins that support the formation of the extracellular matrix in the bone. The diagnosis of OI begins with clinical suspicion, from phenotypic findings at birth, low-impact fractures during childhood or family history that may lead to it. However, the variability in the semiology of the disease does not allow establishing an early diagnosis in all cases, and unfortunately, specific clinical data provided by the literature only report 28 patients with OI type XI...
2017: Application of Clinical Genetics
https://www.readbyqxmd.com/read/29154388/systematic-review-of-the-effect-of-denosumab-on-children-with-osteogenesis-imperfect-showed-inconsistent-findings
#14
Guowei Li, Yanling Jin, Mitchell A H Levine, Heike Hoyer-Kuhn, Leanne Ward, Jonathan D Adachi
Osteogenesis imperfecta (OI) is a rare, inherited disorder characterised by increased bone fragility, reduced bone mass and often short stature. Most cases are due to mutations in one of the two genes encoding collagen type-1 - COL1A1 and COL1A2 (1) - and the signs and symptoms vary substantially with the disease severity. The risk of fractures is 100 times higher than the general population, even in patients with mild OI. Bisphosphonates are the current standard pharmacotherapy for managing and treating patients with severe OI, but concerns about their long-term safety have been raised (1)...
November 20, 2017: Acta Paediatrica
https://www.readbyqxmd.com/read/29150909/genetic-analysis-of-osteogenesis-imperfecta-in-the-palestinian-population-molecular-screening-of-49-affected-families
#15
Osama Essawi, Sofie Symoens, Maha Fannana, Mohammad Darwish, Mohammad Farraj, Andy Willaert, Tamer Essawi, Bert Callewaert, Anne De Paepe, Fransiska Malfait, Paul J Coucke
BACKGROUND: Osteogenesis imperfecta (OI) is a heterogeneous hereditary connective tissue disorder clinically hallmarked by increased susceptibility to bone fractures. METHODS: We analyzed a cohort of 77 diagnosed OI patients from 49 unrelated Palestinian families. Next-generation sequencing technology was used to screen a panel of known OI genes. RESULTS: In 41 probands, we identified 28 different disease-causing variants of 9 different known OI genes...
November 18, 2017: Molecular Genetics & Genomic Medicine
https://www.readbyqxmd.com/read/29109886/radiofrequency-targeted-vertebral-augmentation-case-report-of-a-patient-with-7-osteoporotic-vertebral-fractures-in-a-variant-of-osteogenesis-imperfecta
#16
Leonard Westermann, Peer Eysel, Marvin Simons, Kourosh Zarghooni
Introduction: Radiofrequency-targeted vertebral augmentation (RF-TVA) is a recognized treatment for painful compression fractures. RF-TVA in a patient with multiple compression fractures due to type I osteogenesis imperfecta (OI) has not been previously reported. Case Presentation: A 54-year-old patient with type I OI is presented with a segmental thoracic hyperkyphosis and 7 recent vertebral compression fractures. Because of persistent severe thoracolumbar back pain despite conservative therapy, RF-TVA was indicated...
2017: Case Reports in Orthopedics
https://www.readbyqxmd.com/read/29107738/extracellular-vesicles-released-from-mesenchymal-stromal-cells-stimulate-bone-growth-in-osteogenesis-imperfecta
#17
Satoru Otsuru, Laura Desbourdes, Adam J Guess, Ted J Hofmann, Theresa Relation, Takashi Kaito, Massimo Dominici, Masahiro Iwamoto, Edwin M Horwitz
BACKGROUND: Systemic infusion of mesenchymal stromal cells (MSCs) has been shown to induce acute acceleration of growth velocity in children with osteogenesis imperfecta (OI) despite minimal engraftment of infused MSCs in bones. Using an animal model of OI we have previously shown that MSC infusion stimulates chondrocyte proliferation in the growth plate and that this enhanced proliferation is also observed with infusion of MSC conditioned medium in lieu of MSCs, suggesting that bone growth is due to trophic effects of MSCs...
October 26, 2017: Cytotherapy
https://www.readbyqxmd.com/read/29104038/extremely-low-level-of-serum-pigment-epithelium-derived-factor-is-a-special-biomarker-of-chinese-osteogenesis-imperfecta-patients-with-serpinf1-mutations
#18
Jian-Yi Wang, Lu-Jiao Li, Qian Zhang, Yi Liu, Fang Lv, Xiao-Jie Xu, Yu-Wen Song, Ou Wang, Yan Jiang, Wei-Bo Xia, Xiao-Ping Xing, Mei Li
BACKGROUNDS: SERPINF1 mutations caused deficiency of pigment epithelium-derived factor (PEDF) and would lead to osteogenesis imperfecta (OI) type VI. However, serum PEDF levels were unclear in Chinese OI patients who had clear molecular diagnosis. OBJECTIVE: To assess PEDF levels in different genotypes of OI, to evaluate the influencing factors of PEDF in Chinese OI patients with clear molecular diagnosis. METHODS: Known candidate genes of OI were examined by a targeted next generation sequence...
November 2, 2017: Clinica Chimica Acta; International Journal of Clinical Chemistry
https://www.readbyqxmd.com/read/29101475/insight-into-the-pathology-of-a-col1a1-signal-peptide-heterozygous-mutation-leading-to-severe-osteogenesis-imperfecta
#19
U Lindert, M Gnoli, M Maioli, M F Bedeschi, L Sangiorgi, M Rohrbach, C Giunta
Osteogenesis imperfecta or "brittle bone disease" is a congenital disorder of connective tissue causing the bone to break easily. Around 85-90% of cases are due to autosomal dominant mutations in the genes encoding type I collagen, the major organic component of bone. Genotype-phenotype correlations have shown that quantitative defects of collagen type I lead to mild OI, whereas structural defects show a wide clinical range from mild to perinatal lethal. This may partially be explained by the type of amino acid substitution and the relative location in the domain structure...
November 3, 2017: Calcified Tissue International
https://www.readbyqxmd.com/read/29098346/correction-to-gene-mutation-spectrum-and-genotype-phenotype-correlation-in-a-cohort-of-chinese-osteogenesis-imperfecta-patients-revealed-by-targeted-next-generation-sequencing
#20
Y Liu, Asan, D Ma, F Lv, X Xu, J Wang, W Xia, Y Jiang, O Wang, X Xing, W Yu, J Wang, J Sun, L Song, Y Zhu, H Yang, J Wang, M Li
In Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).
November 2, 2017: Osteoporosis International
keyword
keyword
95793
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"