keyword
MENU ▼
Read by QxMD icon Read
search

authentication

keyword
https://www.readbyqxmd.com/read/28734194/high-yield-one-pot-production-of-18-f-fch-via-a-modified-tracerlab-fxfn-module
#1
Ya-Yao Huang, Chia-Ling Tsai, Hsiang-Ping Wen, Kai-Yuan Tzen, Ruoh-Fen Yen, Chyng-Yann Shiue
INTRODUCTION: [(18)F]Fluoromethylcholine ([(18)F]FCH) is a potent tumors imaging agent. In order to fulfill the demand of pre-clinical and clinical studies, we have developed an automated high yield one-pot synthesis of this potent tumors imaging agent. METHODS: [(18)F]FCH was synthesized using a modified TRACERlab FxFN module. Briefly, dibromomethane (10% in CH3CN) was fluorinated with K[(18)F]/K 2.2.2 in a glassy carbon reaction vessel at 120°C for about 5min to generate [(18)F]fluorobromomethane ([(18)F]FBM)...
July 15, 2017: Applied Radiation and Isotopes
https://www.readbyqxmd.com/read/28734181/evaluating-a-nursing-erasmus-exchange-experience-reflections-on-the-use-and-value-of-the-nominal-group-technique-for-evaluation
#2
Sheila Cunningham
This paper discusses the use of Nominal Group Technique (NGT) for European nursing exchange evaluation at one university. The NGT is a semi-quantitative evaluation method derived from the Delphi method popular in the 1970s and 1980s. The NGT was modified from the traditional version retaining the structured cycles and but adding a broader group discussion. The NGT had been used for 2 successive years but required analysis and evaluation itself for credibility and 'fit' for purpose which is presented here. It aimed to explore nursing students' exchange experiences and aid programme development futures exchanges and closure from exchange...
July 12, 2017: Nurse Education in Practice
https://www.readbyqxmd.com/read/28732070/characterization-of-human-enterovirus71-virus-like-particles-used-for-vaccine-antigens
#3
Dandan Zhao, Bo Sun, Shiyang Sun, Bin Fu, Chuntian Liu, Dawei Liu, Yanfei Chu, Youlei Ma, Lu Bai, Yongge Wu, Yan Zhou, Weiheng Su, Ali Hou, Linjun Cai, Fei Xu, Wei Kong, Chunlai Jiang
Human enterovirus 71 (EV71) is a major causative pathogen of hand, foot and mouth disease (HFMD) and has caused outbreaks with significant mortality among young children in the Asia-Pacific region in recent years. Towards developing a vaccine for this disease, we have expressed and purified EV71 virus-like particles (VLPs), which resemble the authentic virus in appearance, capsid structure and protein sequence, from insect cells (Sf9) using a multistep chromatography process. We demonstrated intracellular localization of the VLPs in host cells by in situ immunogold detection, electron microscopy and immunofluorescence...
2017: PloS One
https://www.readbyqxmd.com/read/28727643/improving-early-adolescent-girls-motor-skill-a-cluster-randomized-controlled-trial
#4
Natalie Lander, Philip J Morgan, Jo Salmon, Lisa M Barnett
BACKGROUND: Physical activity (PA) levels decline substantially during adolescence, and are consistently lower in girls. Competency in a range of fundamental movement skills (FMS) may serve as a protective factor for the decline in PA typically observed in adolescent girls; yet, girls' mastery in FMS is low. Whilst interventions can improve FMS, there is a lack of interventions targeting girls, and very few are conducted in high schools. Additionally, interventions are usually conducted by researchers, not teachers, and thus have little chance of being embedded into curricula...
July 19, 2017: Medicine and Science in Sports and Exercise
https://www.readbyqxmd.com/read/28726362/early-hypertension-after-vasopressor-weaning-during-septic-shock-associated-factors-and-prognostic-significance
#5
Rostane Gaci, Jérémie Lemarie, Marie Conrad, Aurélie Cravoisy, Pierre E Bollaert, Sébastien Gibot
BACKGROUND: During septic shock, early development of hypertension after vasopressors weaning seems paradoxical. The aim of this study was to authenticate this empirical observation, identify associated factors and document its prognostic significance. METHODS: We conducted a descriptive, retrospective study in a medical ICU of a teaching hospital among adult patients with septic shock. RESULTS: From 01.01.2013 to 31.12.2014, 262 consecutive patients over 18 years of age were admitted because of septic shock; 195 of them were successfully weaned from vasopressors...
July 20, 2017: Minerva Anestesiologica
https://www.readbyqxmd.com/read/28725622/authentication-of-piper-betle-l-folium-and-quantification-of-their-antifungal-activity
#6
I Made Agus Gelgel Wirasuta, I Gusti Ayu Made Srinadi, Ida Bagus Gede Dwidasmara, Ni Luh Putu Putri Ardiyanti, I Gusti Ayu Arya Trisnadewi, Ni Luh Putu Vidya Paramita
The TLC profiles of intra- and inter-day precision for Piper betle L. (PBL) folium methanol extract was studied for their peak marker recognition and identification. The Numerical chromatographic parameters (NCPs) of the peak markers, the hierarchical clustering analysis (HCA) and the principal component analysis (PCA) were applied to authenticate the PBL. folium extract from other Piper species folium extract and to ensure the antifungal activity quality of the PBL essential oil. The spotted extract was developed with the mobile phase of toluene: ethyl acetate; 93:7, (v/v)...
July 2017: Journal of Traditional and Complementary Medicine
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#7
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28722604/classification-and-visualization-of-physical-and-chemical-properties-of-falsified-medicines-with-handheld-raman-spectroscopy-and-x-ray-computed-tomography
#8
Tomoko Kakio, Naoko Yoshida, Susan Macha, Kazunobu Moriguchi, Takashi Hiroshima, Yukihiro Ikeda, Hirohito Tsuboi, Kazuko Kimura
Analytical methods for the detection of substandard and falsified medical products (SFs) are important for public health and patient safety. Research to understand how the physical and chemical properties of SFs can be most effectively applied to distinguish the SFs from authentic products has not yet been investigated enough. Here, we investigated the usefulness of two analytical methods, handheld Raman spectroscopy (handheld Raman) and X-ray computed tomography (X-ray CT), for detecting SFs among oral solid antihypertensive pharmaceutical products containing candesartan cilexetil as an active pharmaceutical ingredient (API)...
June 19, 2017: American Journal of Tropical Medicine and Hygiene
https://www.readbyqxmd.com/read/28721842/rapid-seafood-species-identification-using-chip-based-capillary-electrophoresis-and-protein-pattern-matching
#9
Calvin Walker, Cheryl Lassitter, Shannara Lynn, Courtney Ford, Kevin Rademacher, Angela Ruple, Jon Bell
Authenticity is crucial to the seafood industry, as substitution and mislabeling have important economic, environmental, and food safety consequences. To address this problem, protein profiling and software algorithm techniques were developed to classify fish muscle samples by species. The method uses water-based protein extraction, chip-based microfluidic electrophoresis (Agilent 2100 Bioanalyzer) for the analysis of high abundance fish muscle proteins, and a novel data analysis method for species-specific protein pattern recognition...
July 19, 2017: Journal of AOAC International
https://www.readbyqxmd.com/read/28721683/mesenchymal-stem-progenitor-cells-derived-from-articular-cartilage-synovial-membrane-and-synovial-fluid-for-cartilage-regeneration-current-status-and-future-perspectives
#10
REVIEW
Yi-Zhou Huang, Hui-Qi Xie, Antonietta Silini, Ornella Parolini, Yi Zhang, Li Deng, Yong-Can Huang
Large articular cartilage defects remain an immense challenge in the field of regenerative medicine because of their poor intrinsic repair capacity. Currently, the available medical interventions can relieve clinical symptoms to some extent, but fail to repair the cartilaginous injuries with authentic hyaline cartilage. There has been a surge of interest in developing cell-based therapies, focused particularly on the use of mesenchymal stem/progenitor cells with or without scaffolds. Mesenchymal stem/progenitor cells are promising graft cells for tissue regeneration, but the most suitable source of cells for cartilage repair remains controversial...
July 18, 2017: Stem Cell Reviews
https://www.readbyqxmd.com/read/28721203/evaluation-of-mineral-oil-saturated-hydrocarbons-mosh-and-mineral-oil-aromatic-hydrocarbons-moah-in-pure-mineral-hydrocarbon-based-cosmetics-and-cosmetic-raw-materials-using-1-h-nmr-spectroscopy
#11
Dirk W Lachenmeier, Gerd Mildau, Anke Krause, Gerhard Marx, Stephan G Walch, Andrea Hartwig, Thomas Kuballa
Mineral hydrocarbons consist of two fractions, mineral oil saturated hydrocarbons (MOSH) and mineral oil aromatic hydrocarbons (MOAH). MOAH is a potential public health hazard because it may include carcinogenic polycyclic compounds. In the present study, 400 MHz nuclear magnetic resonance (NMR) spectroscopy was introduced, in the context of official controls, to measure MOSH and MOAH in raw materials or pure mineral hydrocarbon final products (cosmetics and medicinal products). Quantitative determination (qNMR) has been established using the ERETIC methodology (electronic reference to access in vivo concentrations) based on the PULCON principle (pulse length based concentration determination)...
2017: F1000Research
https://www.readbyqxmd.com/read/28719621/security-analysis-and-enhanced-user-authentication-in-proxy-mobile-ipv6-networks
#12
Dongwoo Kang, Jaewook Jung, Donghoon Lee, Hyoungshick Kim, Dongho Won
The Proxy Mobile IPv6 (PMIPv6) is a network-based mobility management protocol that allows a Mobile Node(MN) connected to the PMIPv6 domain to move from one network to another without changing the assigned IPv6 address. The user authentication procedure in this protocol is not standardized, but many smartcard based authentication schemes have been proposed. Recently, Alizadeh et al. proposed an authentication scheme for the PMIPv6. However, it could allow an attacker to derive an encryption key that must be securely shared between MN and the Mobile Access Gate(MAG)...
2017: PloS One
https://www.readbyqxmd.com/read/28718398/comparative-study-of-nmr-spectral-profiling-for-the-characterization-and-authentication-of-cannabis
#13
Xinyi Wang, Peter de Harrington, Steven Baugh
For the authentication of botanical materials, it is difficult to obtain representative reference materials because botanicals vary significantly with respect to cultivation conditions. Chemical profiling of plant extracts or spectral fingerprinting can differentiate botanicals and group them by their chemical profiles. NMR spectroscopy yields a powerful and useful method for profiling plant extracts. Both 500 MHz (1)H and (1)H-(1)H correlation NMR spectroscopy coupled with pattern recognition were used to discriminate among Cannabis samples...
July 18, 2017: Journal of AOAC International
https://www.readbyqxmd.com/read/28718274/-microbiome-and-next-generation-sequencing
#14
REVIEW
A Suárez Moya
The human microbiome is an internal ecosystem that refers to the community of microorganisms that populate the human body. These microorganisms are essential to support his health, because the interaction between the host immune system and microorganisms, provide the host with protection against pathogens, and contributes to the preservation of health. Bacteriological culture has been the basis for traditional microbiology; however, most of the bacterial forms observed in nature cannot be isolated with laboratory culture methods...
July 17, 2017: Revista Española de Quimioterapia: Publicación Oficial de la Sociedad Española de Quimioterapia
https://www.readbyqxmd.com/read/28713307/posttraumatic-growth-and-dyadic-adjustment-among-war-veterans-and-their-wives
#15
Yael Lahav, Yaniv Kanat-Maymon, Zahava Solomon
The controversy regarding the nature of posttraumatic growth includes two main competing claims: one which argues that posttraumatic growth reflects authentic positive changes and the other which argues that posttraumatic growth reflects illusory defenses. While the former might suggest that posttraumatic growth enhances intimacy and close relationships, the latter might imply that posttraumatic growth hinders interpersonal relations. The present study aimed to test these claims by investigating the association between posttraumatic growth and dyadic adjustment over time at both the individual and dyadic levels, and the potential role of posttraumatic stress symptoms...
2017: Frontiers in Psychology
https://www.readbyqxmd.com/read/28713150/a-jehovah-s-witness-adolescent-in-the-labor-and-delivery-unit-should-patient-and-parental-refusals-of-blood-transfusions-for-adolescents-be-honored
#16
Johan Christiaan Bester, Martin Smith, Cynthia Griggins
A 15-year-old was admitted to the labor and delivery unit for induction of a 41-week-gestation pregnancy. Her parents, members of Jehovah's Witnesses, and the patient, who had been studying the religion but had not yet been baptized, were adamant that no blood transfusions would be accepted even if a life-threatening hemorrhage were to occur. In our analysis, we examine the underlying ethical conflict and issues raised by this case. We considered two important ethical questions in analyzing the dilemma: first, whether adolescents are capable of providing autonomous and authentic refusals for lifesaving interventions; and second, whether parents can refuse such interventions for their adolescent children based on their religious beliefs...
2017: Narrative Inquiry in Bioethics
https://www.readbyqxmd.com/read/28711695/identification-of-a-conformational-neutralizing-epitope-on-the-vp1-protein-of-type-a-foot-and-mouth-disease-virus
#17
Wenming Liu, Baolin Yang, Mingxia Wang, Haiwei Wang, Decheng Yang, Wenge Ma, Guohui Zhou, Li Yu
Foot-and-mouth disease (FMD) caused by foot-and-mouth disease virus (FMDV), is a highly contagious infectious disease that affects domestic and wild cloven-hoofed animals worldwide. In recent years, outbreaks of serotype A FMD have occurred in many countries. High-affinity neutralizing antibodies against a conserved epitope could provide protective immunity against diverse subtypes of FMDV serotype A and protect against future pandemics. In this study, we generated a serotype A FMDV-specific potent neutralizing monoclonal antibody (MAb), 6C9, which recognizes a conformation-dependent epitope...
July 8, 2017: Research in Veterinary Science
https://www.readbyqxmd.com/read/28710428/the-use-of-a-hybrid-sequential-biofiltration-system-for-the-improvement-of-nutrient-removal-and-pcb-control-in-municipal-wastewater
#18
Edyta Kiedrzyńska, Magdalena Urbaniak, Marcin Kiedrzyński, Adam Jóźwik, Agnieszka Bednarek, Ilona Gągała, Maciej Zalewski
This article aims to evaluate the efficiency of an innovative hybrid Sequential Biofiltration System (SBS) for removing phosphorus and nitrogen and polychlorinated biphenyls (PCBs) from original municipal wastewater produced by a Wastewater Treatment Plant under authentic operating conditions. The hybrid SBS was constructed with two barriers, a geochemical (filtration beds with limestone, coal and sawdust) and a biological barrier (wetlands with Glyceria, Acorus, Typha, Phragmites), operating in parallel. Significant differences were found between inflow and outflow from the SBS with regard to wastewater contaminant concentrations, the efficiency of removal being 16% (max...
July 14, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28708166/low-photon-count-based-digital-holography-for-quadratic-phase-cryptography
#19
Inbarasan Muniraj, Changliang Guo, Ra'ed Malallah, James P Ryle, John J Healy, Byung-Geun Lee, John T Sheridan
Recently, the vulnerability of the linear canonical transform-based double random phase encryption system to attack has been demonstrated. To alleviate this, we present for the first time, to the best of our knowledge, a method for securing a two-dimensional scene using a quadratic phase encoding system operating in the photon-counted imaging (PCI) regime. Position-phase-shifting digital holography is applied to record the photon-limited encrypted complex samples. The reconstruction of the complex wavefront involves four sparse (undersampled) dataset intensity measurements (interferograms) at two different positions...
July 15, 2017: Optics Letters
https://www.readbyqxmd.com/read/28706610/a-novel-variant-of-oct4-entitled-oct4b3-is-expressed-in-human-bladder-cancer-and-astrocytoma-cell-lines
#20
Ensieh M Poursani, Majid Mehravar, Bahram Mohammad Soltani, Seyed Javad Mowla, James E Trosko
BACKGROUND: Alternative splicing is an important mechanism that regulates gene expression and function in human cells. OCT4, a crucial pluripotency marker in embryonic stem/carcinoma cells generates several spliced variants in different cell types and cancers. The expression of OCT4 in cancers has been challenged in many studies. The existence of several OCT4 spliced variants and absence of specific discriminating primers is the main reason of this controversy. Therefore, using specific primers and discriminating OCT4 variants from each other might help to reduce these discrepancies in carcinogenesis and stem cell researches...
July 2017: Avicenna Journal of Medical Biotechnology
keyword
keyword
84459
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"