keyword
MENU ▼
Read by QxMD icon Read
search

Nf2

keyword
https://www.readbyqxmd.com/read/29138018/anti-tumor-effects-of-cold-atmospheric-pressure-plasma-on-vestibular-schwannoma-demonstrate-its-feasibility-as-an-intra-operative-adjuvant-treatment
#1
Yeo Jun Yoon, Michelle J Suh, Hyun Young Lee, Hae June Lee, Eun Ha Choi, In Seok Moon, Kiwon Song
Vestibular schwannoma (VS), although a benign intracranial tumor, causes morbidities by brainstem compression. Since chemotherapy is not very effective in most Nf2-negative schwannomas, surgical removal or radiation therapy is required. However, depending on the size and site of the tumor, these approaches may cause loss of auditory or vestibular functions, and severely decrease the post-surgical wellbeing. Here, we examined the feasibility of cold atmospheric pressure plasma (CAP) as an intra-operative adjuvant treatment for VS after surgery...
November 11, 2017: Free Radical Biology & Medicine
https://www.readbyqxmd.com/read/29130106/molecular-alterations-of-the-nf2-gene-in-hepatocellular-carcinoma-and-intrahepatic-cholangiocarcinoma
#2
Ning Zhang, Zhang Zhao, Jiang Long, Hai Li, Bei Zhang, Guangyong Chen, Xiaojin Li, Tingxia Lv, Wei Zhang, Xiaojuan Ou, Anjian Xu, Jian Huang
Neurofibromatosis type 2 with mutations in the neurofibromin 2 (NF2) gene, encoding the Merlin protein, is an autosomal dominant disorder characterized by enhanced cancer predisposition, particularly tumors of the central nervous system. Recent animal studies indicate that disruption of NF2/Merlin function in oval cells, which are hepatic progenitor cells, may lead to the development of primary liver cancers including hepatocellular carcinoma (HCC) and intrahepatic cholangiocarcinoma (ICC); however, its role in human primary liver cancer remains unclear...
December 2017: Oncology Reports
https://www.readbyqxmd.com/read/29119424/health-literacy-assessment-in-adults-with-neurofibromatosis-electronic-and-short-form-measurement-using-fcchl-and-health-litt
#3
Vanessa L Merker, Sarah McDannold, Eric Riklin, Mojtaba Talaei-Khoei, Monica R Sheridan, Justin T Jordan, Scott R Plotkin, Ana-Maria Vranceanu
Determining health literacy level is an important prerequisite for effective patient education. We assessed multiple dimensions of health literacy and sociodemographic predictors of health literacy in patients with neurofibromatosis. In 86 individuals with a confirmed diagnosis of neurofibromatosis 1 (NF1), neurofibromatosis 2 (NF2), or schwannomatosis, we assessed health literacy status using two HL tools-the adapted functional, communicative, and critical health literacy scale (adapted FCCHL) and health literacy assessment using talking touchscreen technology (Health LiTT)...
November 8, 2017: Journal of Neuro-oncology
https://www.readbyqxmd.com/read/29115758/neurofibromatosis-and-the-role-of-the-specialist-adviser
#4
Carolyn Redman
Neurofibromatosis (NF) is a genetic condition that mainly involves the nervous system. There are two types: NF1 affects about one in 2,500 of the population worldwide and NF2 affects one in 35,000. Both types result in complex health problems for patients and can pose significant challenges for all those involved in their management. Established in 1981, The Neuro Foundation is a patient-focused charity that funds a network of specialist advisers who work in partnership with the NHS to offer support and advice for families affected by NF and the professionals who care for them...
September 11, 2017: Nursing Children and Young People
https://www.readbyqxmd.com/read/29095749/genetics-of-vestibular-syndromes
#5
Pablo Roman-Naranjo, Alvaro Gallego-Martinez, Jose A Lopez Escamez
PURPOSE OF REVIEW: The increased availability of next generation sequencing has enabled a rapid progress in the discovery of genetic variants associated with vestibular disorders. We have summarized molecular genetics finding in vestibular syndromes during the last 18 months. RECENT FINDINGS: Genetic studies continue to shed light on the genetic background of vestibular disorders. Novel genes affecting brain development and otolith biogenesis have been associated with motion sickness...
November 1, 2017: Current Opinion in Neurology
https://www.readbyqxmd.com/read/29088993/an-update-on-the-diagnosis-and-treatment-of-vestibular-schwannoma
#6
Jane Halliday, Scott A Rutherford, Martin G McCabe, Dafydd G Evans
Vestibular schwannomas (VS) account for approximately 85% of tumors in the cerebello-pontine angle, with a lifetime incidence of approximately 1 in 1000. Most are sporadic, with approximately 5% related to the tumor predisposition syndrome Neurofibromatosis Type 2 (NF2). The mainstays of management strategies are: observation, surgery, radiosurgery/radiotherapy and, for patients with NF2 and rapidly growing tumors or deteriorating neurologic function the targeted therapy bevacizumab. While morbidity and mortality rates related to treatment of VS have improved dramatically over the last decades, there are still significant improvements that could be made, in particular with regards to long-term facial nerve and hearing outcomes...
November 7, 2017: Expert Review of Neurotherapeutics
https://www.readbyqxmd.com/read/29045680/report-of-a-novel-case-of-anaplastic-olfactory-groove-meningioma-and-its-methylation-subtype
#7
Aaron Song Chuan Foo, Dominic Ti Ming Tan, Char Loo Tan, Felix Sahm, Andreas von Deimling, Tseng Tsai Yeo
We report a novel case of a World Health Organization grade 3 anaplastic meningioma arising from the olfactory groove in an 83-year-old woman. Molecular and methylation profiling confirm this lesion to be an NF2 subtype, methylation class intermediate type B meningioma. As most meningiomas in this location are indolent SMO subtype lesions, our report suggests that even though rare, aggressive NF2 subtype meningiomas can also occur along the midline anterior skull base.
December 1, 2017: Journal of Neuropathology and Experimental Neurology
https://www.readbyqxmd.com/read/29039306/paenibacillus-azotifigens-sp-nov-a-novel-nitrogen-fixing-bacterium-isolated-from-paddy-soil
#8
Muhammad Zubair Siddiqi, Gyu-Min Choi, Kang Duk Choi, Wan-Taek Im
A nitrogen-fixing bacterium, designated NF2-4-5(T), was isolated from a paddy soil in Anseong City, Korea. Cells of strain NF2-4-5(T) were Gram-staining-positive, motile rods and aerobic. Phylogenetic analysis based on 16S rRNA gene sequence comparison revealed that the strain formed a distinct lineage within the genus Paenibacillus and was closely related to Paenibacillus graminis RSA19(T) (98.7 %), Paenibacillus jilunlii Be17(T) (98.6 %), Paenibacillus salinicaeni LAM0A28(T) (98.6 %) and Paenibacillus riograndensis SBR5(T) (98...
October 17, 2017: International Journal of Systematic and Evolutionary Microbiology
https://www.readbyqxmd.com/read/29036751/-diagnosis-and-management-of-vestibular-schwannomas-an-interdisciplinary-challenge
#9
Steffen Rosahl, Christopher Bohr, Michael Lell, Klaus Hamm, Heinrich Iro
Vestibular schwannomas expand slowly in the internal auditory canal, in the cerebellopontine angle, inside the cochlear and the labyrinth. Larger tumors can displace and compress the brainstem. With an annual incidence of 1:100 000 vestibular schwannoma represent 6-7% of all intracranial tumors. In the cerebellopontine angle they are by far the most neoplasm with 90% of all lesions located in this region. Magnetic resonance imaging (MRI), audiometry, and vestibular diagnostics are the mainstays of the clinical workup for patients harboring tumors...
April 2017: Laryngo- Rhino- Otologie
https://www.readbyqxmd.com/read/29036698/chromosomal-context-affects-the-molecular-evolution-of-sex-linked-genes-and-their-autosomal-counterparts-in-turtles-and-other-vertebrates
#10
Srihari Radhakrishnan, Nicole Valenzuela, Melissa Wilson Sayres
Sex chromosomes evolve differently from autosomes because natural selection acts distinctly on them given their reduced recombination and smaller population size. Various studies of sex-linked genes compared with different autosomal genes within species support these predictions. Here, we take a novel alternative approach by comparing the rate of evolution between subsets of genes that are sex-linked in selected reptiles/vertebrates and the same genes located in autosomes in other amniotes. We report for the first time the faster evolution of Z-linked genes in a turtle (the Chinese softshell turtle Pelodiscus sinensis) relative to autosomal orthologs in other taxa, including turtles with temperature-dependent sex determination (TSD)...
October 30, 2017: Journal of Heredity
https://www.readbyqxmd.com/read/29025865/publisher-s-note-rho-differentially-regulates-the-hippo-pathway-by-modulating-the-interaction-between-amot-and-nf2-in-the-blastocyst-development-doi-10-1242-dev-157917
#11
Xianle Shi, Zixi Yin, Bin Ling, Lingling Wang, Chang Liu, Xianhui Ruan, Weiyu Zhang, Lingyi Chen
No abstract text is available yet for this article.
October 12, 2017: Development
https://www.readbyqxmd.com/read/28981922/-analysis-of-nf2-gene-mutations-in-intraspinal-schwannomas
#12
Shuyi Liu, Shi Chen, Kaichuang Zhang, Jian Lin, Qingwu Yang, Yongliang Zhang, Shuiyuan Liu, Shengze Liu
OBJECTIVE: To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene. METHODS: Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing. RESULTS: Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c...
October 10, 2017: Zhonghua Yi Xue Yi Chuan Xue za Zhi, Zhonghua Yixue Yichuanxue Zazhi, Chinese Journal of Medical Genetics
https://www.readbyqxmd.com/read/28973692/malignant-peripheral-nerve-sheath-tumors-are-not-a-feature-of-neurofibromatosis-type-2-in-the-unirradiated-patient
#13
Andrew T King, Scott A Rutherford, Charlotte Hammerbeck-Ward, Simon K Lloyd, Simon R Freeman, Omar N Pathmanaban, Mark Kellett, Rupert Obholzer, Shazia Afridi, Patrick Axon, Dorothy Halliday, Allyson Parry, Owen M Thomas, Roger D Laitt, Martin G McCabe, Stavros Stivaros, Sara Erridge, D Gareth Evans
BACKGROUND: The published literature suggests that malignant peripheral nerve sheath tumors (MPNST) occur at increased frequency in neurofibromatosis type 2 (NF2). A recent review based on incidence data in North America showed that 1 per 1000 cerebellopontine angle nerve sheath tumors were malignant. OBJECTIVE: To determine whether MPNST occurred spontaneously in NF2 by reviewing our NF2 database. METHODS: The prospective database consists of 1253 patients with NF2...
July 20, 2017: Neurosurgery
https://www.readbyqxmd.com/read/28973691/high-grade-glioma-is-not-a-feature-of-neurofibromatosis-type-2-in-the-unirradiated-patient
#14
Andrew T King, Scott A Rutherford, Charlotte Hammerbeck-Ward, Simon K Lloyd, Simon M Freeman, Omar N Pathmanaban, Monica Rodriguez-Valero, Owen M Thomas, Roger D Laitt, Stavros Stivaros, Mark Kellett, D Gareth Evans
BACKGROUND: The Manchester criteria for neurofibromatosis type 2 (NF2) include a range of tumors, and gliomas were incorporated in the original description. The gliomas are now widely accepted to be predominantly spinal cord ependymomas. OBJECTIVE: To determine whether these gliomas include any cases of malignant glioma (WHO grade III and IV) through a database review. METHODS: The prospective database consists of 1253 patients with NF2. 1009 are known to be alive at last follow-up...
July 21, 2017: Neurosurgery
https://www.readbyqxmd.com/read/28972170/%C3%AE-1-integrin-dependent-rac-group-i-pak-signaling-mediates-yap-activation-of-yes-associated-protein-1-yap1-via-nf2-merlin
#15
Hiba Sabra, Molly Brunner, Vinay Mandati, Bernhard Wehrle Haller, Dominique Lallemand, Anne-Sophie Ribba, Genevieve Chevalier, Philippe Guardiola, Marc R Block, Daniel Bouvard
Cell adhesion to the extracellular matrix or to surrounding cells plays a key role in cell proliferation and differentiation, and is critical for proper tissue homeostasis. An important pathway in adhesion-dependent cell proliferation is the Hippo signaling cascade, which is coregulated by the transcription factors Yes-associated protein 1 (YAP1) and transcriptional coactivator with PDZ-binding motif (TAZ). However, how cells integrate extracellular information at the molecular level to regulate YAP1 nuclear localization is still puzzling...
September 29, 2017: Journal of Biological Chemistry
https://www.readbyqxmd.com/read/28964288/the-value-of-intraoperative-eabrs-in-auditory-brainstem-implantation
#16
Abbas Anwar, Alison Singleton, Yixin Fang, Binhuan Wang, William Shapiro, J Thomas Roland, Susan B Waltzman
OBJECTIVE: To compare the intraoperative electrically evoked auditory brainstem response (EABR) morphologies between neurofibromatosis II (NF2) adult auditory brainstem implant (ABI) recipients who had auditory percepts post-operatively and those who did not and between NF2 adult ABI recipients and non-NF2 pediatric ABI recipients. METHODS: This was a retrospective case series at a single tertiary academic referral center examining all ABI recipients from 1994 to 2016, which included 34 NF2 adults and 11 non-NF2 children...
October 2017: International Journal of Pediatric Otorhinolaryngology
https://www.readbyqxmd.com/read/28947533/rho-differentially-regulates-the-hippo-pathway-by-modulating-the-interaction-between-amot-and-nf2-in-the-blastocyst
#17
Xianle Shi, Zixi Yin, Bin Ling, Lingling Wang, Chang Liu, Xianhui Ruan, Weiyu Zhang, Lingyi Chen
The Hippo pathway modulates the transcriptional activity of Yap to regulate the differentiation of the inner cell mass (ICM) and the trophectoderm (TE) in blastocysts. Yet, how Hippo signaling is differentially regulated in ICM and TE cells is poorly understood. Through an inhibitor/activator screen, we identified Rho as a negative regulator of Hippo in TE cells, and PKA as a positive regulator of Hippo in ICM cells. We further elucidated a novel mechanism for Rho to suppress Hippo, distinct to the prevailing view that Rho inhibits Hippo signaling through modulating cytoskeleton remodeling and/or cell polarity...
September 25, 2017: Development
https://www.readbyqxmd.com/read/28934903/reduced-rac1-activity-inhibits-cell-proliferation-and-induces-apoptosis-in-neurofibromatosis-type-2-nf2-associated-schwannoma
#18
Ying Wang, Bo Wang, Peng Li, Qi Zhang, Pinan Liu
Objective To study the function and potential mechanism of RAC1 inhibitors in NF2-associated schwannoma. Methods In this study, we the downregulation of RAC1 activity and tumor cell phenotypes by RAC1 inhibitor NSC23766 in vitro. And we further validated the anti-proliferation effect by this RAC1 inhibitor in subcutaneous xenograft tumor model and sciatic nerve model. Results Pharmacological inhibition of RAC1 could significantly inhibit the proliferation of both RT4 cells and human NF2-associated primary schwannoma cells by inducing apoptosis...
September 22, 2017: Neurological Research
https://www.readbyqxmd.com/read/28923059/osteoglycin-promotes-meningioma-development-through-downregulation-of-nf2-and-activation-of-mtor-signaling
#19
Yu Mei, Ziming Du, Changchen Hu, Noah F Greenwald, Malak Abedalthagafi, Nathalie Y R Agar, Gavin P Dunn, Wenya Linda Bi, Sandro Santagata, Ian F Dunn
BACKGROUND: Meningiomas are the most common primary intracranial tumors in adults. While a majority of meningiomas are slow growing neoplasms that may cured by surgical resection, a subset demonstrates more aggressive behavior and insidiously recurs despite surgery and radiation, without effective alternative treatment options. Elucidation of critical mitogenic pathways in meningioma oncogenesis may offer new therapeutic strategies. We performed an integrated genomic and molecular analysis to characterize the expression and function of osteoglycin (OGN) in meningiomas and explored possible therapeutic approaches for OGN-expressing meningiomas...
September 18, 2017: Cell Communication and Signaling: CCS
https://www.readbyqxmd.com/read/28910456/identification-of-alk-rearrangements-in-malignant-peritoneal-mesothelioma
#20
Yin P Hung, Fei Dong, Jaclyn C Watkins, Valentina Nardi, Raphael Bueno, Paola Dal Cin, John J Godleski, Christopher P Crum, Lucian R Chirieac
Importance: Malignant peritoneal mesothelioma is a rare, aggressive tumor arising from the peritoneal lining, induced by asbestos, therapeutic radiation, or germline mutations. Nevertheless, the molecular features remain largely unknown. Objective: To investigate anaplastic lymphoma kinase (ALK) rearrangements in a large series of peritoneal mesothelioma and characterize the mutational landscape of these tumors. Design, Setting, and Participants: We studied 88 consecutive patients (39 men, 49 women; median age 61, range 17-84 years) with peritoneal mesotheliomas diagnosed at a single institution between 2005 and 2015...
September 14, 2017: JAMA Oncology
keyword
keyword
77364
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"