keyword
https://read.qxmd.com/read/37525697/sequencing-the-sars-cov-2-genome-from-stool-samples-of-post-acute-cases-implicates-a-novel-mutation-associated-with-reduced-antibody-neutralization
#21
JOURNAL ARTICLE
Natalya Panova, Nina P Allan, Noelle C Rubas, Rosa H Lee, Braden P Kunihiro, Lesley Umeda, Rafael Peres, Ruben Juarez, Alika K Maunakea
Whole-genome SARS-CoV-2 sequencing tools are crucial for tracking the COVID-19 pandemic. However, current techniques require sampling of actively infectious patients following COVID-19 testing to recover enough SARS-CoV-2 RNA from the nasopharyngeal passage, which rapidly clears during the first few weeks of infection. A prospective assessment of the viral genome sourced from recovered non-infectious patients would greatly facilitate epidemiological tracking. Thus, we developed a protocol to isolate and sequence the genome of SARS-CoV-2 from stool samples of post-acute SARS-CoV-2 patients, at timepoints ranging from 10-120 days after onset of symptoms...
2023: Eur J Biomed Res
https://read.qxmd.com/read/37474944/defining-critical-illness-using-immunological-endotypes-in-patients-with-and-without-sepsis-a-cohort-study
#22
JOURNAL ARTICLE
Jeremy A Balch, Uan-I Chen, Oliver Liesenfeld, Petr Starostik, Tyler J Loftus, Philip A Efron, Scott C Brakenridge, Timothy E Sweeney, Lyle L Moldawer
BACKGROUND: Sepsis is a heterogenous syndrome with limited therapeutic options. Identifying immunological endotypes through gene expression patterns in septic patients may lead to targeted interventions. We investigated whether patients admitted to a surgical intensive care unit (ICU) with sepsis and with high risk of mortality express similar endotypes to non-septic, but still critically ill patients using two multiplex transcriptomic metrics obtained both on admission to a surgical ICU and at set intervals...
July 20, 2023: Critical Care: the Official Journal of the Critical Care Forum
https://read.qxmd.com/read/37344942/agave-attenuata-and-agave-amica-new-hosts-of-tuberose-mild-mosaic-virus-in-mexico
#23
JOURNAL ARTICLE
Rodolfo De la Torre-Almaraz, David Vargas-Peralta, Mario Salazar-Segura, Vicente Pallas, Jesus Sanchez-Navarro
Agave attenuata is a Mexican wild plant originally from highlands in the central and occidental mountains of Mexico. This species, known as "swan´s neck agave", is used only as an ornamental plant in public and private gardens. No virus had previously been reported from A. attenuata before this study. In a survey conducted in a commercial greenhouse in Cuautla, Morelos, in 2018, several plants were observed with symptoms of green mosaic and streaks, consistent with a putative viral infection. Sap inoculation from symptomatic A...
June 21, 2023: Plant Disease
https://read.qxmd.com/read/37272047/first-report-of-tomato-spotted-wilt-virus-infecting-helichrysum-bracteatum-in-china
#24
JOURNAL ARTICLE
Sha-Sha Zhang, Chen-Qing Yuan, Yan Liang, Chu-Ze Shen, Li-Fang Li
Strawflower ( Helichrysum bracteatum , Asteraceae) , an annual or biennial herb, is one of the most popular flowers in the world because of the colorful flowers and the long flowering period. However, the ornamental plants belonging to Asteraceae are susceptible to numerous viruses such as cucumber mosaic virus (CMV) ( Cucumovirus , Bromoviridae) , potato virus Y ( Potyvirus , Potyviridae), tomato mosaic virus (ToMV) ( Tobamovirus , Virgaviridae), tobacco mosaic virus (TMV) ( Tobamovirus , Virgaviridae), chrysanthemum virus B (CVB) ( Carlavirus , Betaflexiviridae), tomato aspermy virus (TAV) ( Cucumovirus , Bromoviridae), tomato spotted wilt virus (TSWV) ( Orthotospovirus tomatomaculae , Tospoviridae), and impatiens necrotic spot virus (INSV) ( Orthotospovirus impatiensnecromaculae , Orthotospovirus) resulting in severe yield loss (Verma et al...
June 4, 2023: Plant Disease
https://read.qxmd.com/read/37244966/targeting-long-non-coding-rna-malat1-reverses-cancerous-phenotypes-of-breast-cancer-cells-through-microrna-561-3p-top2a-axis
#25
JOURNAL ARTICLE
Sara Hajibabaei, Nahid Nafissi, Yasamin Azimi, Reza Mahdian, Fatemeh Rahimi-Jamnani, Vahideh Valizadeh, Mohammad Hessam Rafiee, Masoumeh Azizi
Non-coding RNAs, including Inc-RNA and miRNA, have been reported to regulate gene expression and are associated with cancer progression. MicroRNA-561-3p (miR-561-3p), as a tumor suppressor, has been reported to play a role in preventing cancer cell progression, and MALAT1 (Lnc-RNA) have also been demonstrated to promote malignancy in various cancers, such as breast cancer (BC). In this study, we aimed to determine the correlation between miR-561-3p and MALAT1 and their roles in breast cancer progression. The expression of MALAT1, mir-561-3p, and topoisomerase alpha 2 (TOP2A) as a target of miR-561-3p was determined in BC clinical samples and cell lines via qRT-PCR...
May 27, 2023: Scientific Reports
https://read.qxmd.com/read/37227438/first-report-of-passiflora-latent-virus-infecting-passion-fruit-passiflora-edulis-in-south-korea
#26
JOURNAL ARTICLE
Min-Kyung Choi, Ho-Jong Ju
Passion fruit (Passiflora edulis) viral diseases caused by papaya leaf curl Guangdong virus, cucumber mosaic virus, East Asian Passiflora virus, and euphorbia leaf curl virus have been reported in South Korea (Joa et al. 2018; Kim et al. 2018). In June 2021, virus-like symptoms, e.g., mosaic pattern, curling, chlorosis, and deformation, were observed on leaves and fruits of greenhouse-grown P. edulis in Iksan, South Korea, with disease incidence greater than 2% (300 plants: 8 symptomatic plants and 292 asymptomatic plants)...
May 25, 2023: Plant Disease
https://read.qxmd.com/read/37214996/defining-critical-illness-using-immunological-endotypes-in-patients-with-and-without-of-sepsis-a-cohort-study
#27
Jeremy A Balch, Uan-I Chen, Oliver Liesenfeld, Petr Starostik, Tyler J Loftus, Philip A Efron, Scott C Brakenridge, Timothy E Sweeney, Lyle L Moldawer
Background: Sepsis is a heterogenous syndrome with limited therapeutic options. Identifying characteristic gene expression patterns, or endotypes, in septic patients may lead to targeted interventions. We investigated whether patients admitted to a surgical ICU with sepsis and with high risk of mortality express similar endotypes to non-septic, but still critically ill patients using two multiplex transcriptomic metrics obtained both on admission to a surgical intensive care unit (ICU) and at set intervals...
May 8, 2023: Research Square
https://read.qxmd.com/read/37097201/screening-for-zika-virus-in-u-s-armed-services-blood-program-donors-an-opportunity-to-compare-emerging-infectious-disease-risk-between-the-general-u-s-population-and-military-donors
#28
JOURNAL ARTICLE
Chriselda G Fedyk, George M Shahin, Ronnie Hill, Andrew P Cap
BACKGROUND: The U.S. Department of Defense (DoD) collects blood from volunteer DoD donors in U.S. Food and Drug Administration (FDA)-regulated centers, and from emergency donor panels in overseas operations. Emerging infectious diseases could reduce DoD access to blood products. In August 2016, FDA determined that Zika virus was transfusion-transmitted and advised that donated blood should be screened for Zika utilizing one of two investigational new drug (IND) applications. The Armed Services Blood Program (ASBP) tested blood using its own protocol concurrently with the IND study sponsored by Roche Molecular Systems, Inc...
April 25, 2023: Transfusion
https://read.qxmd.com/read/37067206/-investigation-of-efflux-pump-genes-in-resistant-mycobacterium-tuberculosis-complex-clinical-isolates-exposed-to-first-line-antituberculosis-drugs-and-verapamil-combination
#29
JOURNAL ARTICLE
Didem Özgür, Leyla Ersoy, Mahmut Ülger, Seda Tezcan Ülger, Gönül Aslan
Tuberculosis (TB) is caused by Mycobacterium tuberculosis, still one of the most common life-threatening infectious diseases worldwide. Although drug resistance in M.tuberculosis is mainly due to spontaneous chromosomal mutations in genes encoding drug target or drug activating enzymes, the resistance cannot be explained only by these mutations. Low permeability of the cell wall, drug inactivating enzymes and especially efflux pumps (EPs) are other mechanisms of drug resistance in mycobacteria. Efflux pump inhibitors (EPIs) binding to M...
April 2023: Mikrobiyoloji Bülteni
https://read.qxmd.com/read/36802299/first-reports-of-beet-curly-top-virus-citrus-yellow-vein-associated-virus-and-hop-latent-viroid-in-industrial-hemp-cannabis-sativa-in-washington-state
#30
JOURNAL ARTICLE
Sridhar Jarugula, Camille Wagstaff, Arunabha Mitra, David Crowder, David Gang, Naidu Rayapati
In 2021 and 2022, virus-like symptoms were observed in several cultivars of industrial hemp (Cannabis sativa) in two fields in central Washington, USA. Affected plants had a range of symptoms at different developmental stages, with young plants having severe stunting with shortened internodes and reduced flower mass. Young leaves of infected plants also showed light green to total yellowing, and twirling with twisting margins (Fig. S1). Infections of older plants caused less foliar symptoms that consisted of mosaic, mottling, and mild chlorosis on a few branches with tacoing of older leaves...
February 21, 2023: Plant Disease
https://read.qxmd.com/read/36793022/oral-contraceptive-pill-ocp-treatment-alters-the-gene-expression-of-intercellular-adhesion-molecule-1-icam-1-tumor-necrosis-factor-%C3%AE-tnf-%C3%AE-monocyte-chemoattractant-protein-1-mcp-1-and-plasminogen-activator-inhibitor-1-pai-1-in-polycystic-ovary-syndrome-pcos
#31
COMPARATIVE STUDY
Syed Douhath Yousuf, Mohammad Ashraf Ganie, Uneeb Urwat, Syed Mudasir Andrabi, Mohammad Afzal Zargar, Mashooq Ahmad Dar, Mir Manzoor-Ul-Rehman, Syed Mudassar, Fouzia Rashid
BACKGROUND: Polycystic ovary syndrome (PCOS) presents clinical symptoms of menstrual abnormalities, excessive hair growth (hirsutism), scalp hair loss, acne and infertility. Metabolic abnormalities such as obesity, insulin resistance, glucose intolerance and cardiovascular problems constitute an essential part of PCOS, all of which can have significant long-term health consequences. Low-grade chronic inflammation demonstrated by persistent moderately elevated serum levels of inflammatory and coagulatory markers plays a critical role in the pathogenesis of PCOS...
February 15, 2023: BMC Women's Health
https://read.qxmd.com/read/36743521/trk-inhibitor-in-a-patient-with-metastatic-triple-negative-breast-cancer-and-ntrk-fusions-identified-via-cell-free-dna-analysis
#32
Arielle J Medford, Lauren Oshry, Baris Boyraz, Lesli Kiedrowski, Sofia Menshikova, Anna Butusova, Charles S Dai, Tasos Gogakos, Jennifer C Keenan, Rachel H Occhiogrosso, Phoebe Ryan, Jochen K Lennerz, Laura M Spring, Beverly Moy, Leif W Ellisen, Aditya Bardia
Tissue-agnostic indications for targeted therapies have expanded options for patients with advanced solid tumors. The Food and Drug Administration approvals of the programmed death-ligand 1 inhibitor pembrolizumab and the TRK inhibitors larotrectinib and entrectinib provide rationale for next-generation sequencing (NGS) in effectively all advanced solid tumor patients given potential for clinical responses even in otherwise refractory disease. As proof of concept, this case report describes a 64-year-old woman with triple-negative breast cancer refractory to multiple lines of therapy, found to have a rare mutation on NGS which led to targeted therapy with meaningful response...
2023: Therapeutic Advances in Medical Oncology
https://read.qxmd.com/read/36734939/first-report-of-citrus-leaf-blotch-virus-infecting-viburnum-lentago-in-south-korea
#33
JOURNAL ARTICLE
Myung-Hwi Kim, Hee-Seong Byun, Hae-Ryun Kwak, Sun-Jung Kwon, Jang-Kyun Seo
Viburnum lentago (family Adoxaceae) is a perennial plant species native to northeastern United States and southern Canada. Globally, V. lentago is a popular garden plant due to its abundant flowers and beautiful autumnal color. V. lentago is also commercially cultivated for medicinal purposes because its roots and fruits can be used in herbal preparations (Jiao et al. 2021). In June 2022, virus-like symptoms of vein chlorosis and yellowing were observed in the leaves of many V. lentago trees planted in a public park in Wonju, South Korea...
February 3, 2023: Plant Disease
https://read.qxmd.com/read/36623238/pan-cancer-landscape-of-programmed-death-ligand-1-and-programmed-death-ligand-2-structural-variations
#34
JOURNAL ARTICLE
Emily L Hoskins, Eric Samorodnitsky, Michele R Wing, Julie W Reeser, Julia F Hopkins, Karthikeyan Murugesan, Zheng Kuang, Raven Vella, Leah Stein, Zachary Risch, Lianbo Yu, Serifat Adebola, Anoosha Paruchuri, John Carpten, Jad Chahoud, Stephen Edge, Jill Kolesar, Martin McCarter, Kenneth G Nepple, Matthew Reilley, Courtney Scaife, Abhishek Tripathi, Nancy Single, Richard S P Huang, Lee A Albacker, Sameek Roychowdhury
PURPOSE: Programmed cell death protein-1 (PD-1) receptor and ligand interactions are the target of immunotherapies for more than 20 cancer types. Biomarkers that predict response to immunotherapy are microsatellite instability, tumor mutational burden, and programmed death ligand-1 (PD-L1) immunohistochemistry. Structural variations (SVs) in PD-L1 ( CD274 ) and PD-L2 ( PDCD1LG2 ) have been observed in cancer, but the comprehensive landscape is unknown. Here, we describe the genomic landscape of PD-L1 and PD-L2 SVs, their potential impact on the tumor microenvironment, and evidence that patients with these alterations can benefit from immunotherapy...
January 2023: JCO Precision Oncology
https://read.qxmd.com/read/36579028/cancer-immune-profiling-unveils-biomarkers-immunological-pathways-and-cell-type-score-associated-with-glioblastoma-patients-survival
#35
JOURNAL ARTICLE
Daniel Antunes Moreno, Luciane Sussuchi da Silva, Isabella Gomes, Letícia Ferro Leal, Gustavo Noriz Berardinelli, Gisele Melo Gonçalves, Caio Augusto Pereira, Iara Viana Vidigal Santana, Marcus de Medeiros Matsushita, Krishna Bhat, Sean Lawler, Rui Manuel Reis
INTRODUCTION: Glioblastoma (GBM), isocitrate dehydrogenase ( IDH ) wild-type ( IDH wt ), and grade 4 astrocytomas, IDH mutant ( IDH mut ), are the most common and aggressive primary malignant brain tumors in adults. A better understanding of the tumor immune microenvironment may provide new biomarkers and therapeutic opportunities. OBJECTIVES: We aimed to evaluate the expression profile of 730 immuno-oncology-related genes in patients with IDH wt GBM and IDH mut tumors and identify prognostic biomarkers and a gene signature associated with patient survival...
2022: Therapeutic Advances in Medical Oncology
https://read.qxmd.com/read/36562681/an-open-chat-with%C3%A2-simon-rayner
#36
JOURNAL ARTICLE
Ioannis Tsagakis, Simon Rayner
Simon Rayner joined the FEBS Open Bio Editorial Board in March 2022. Currently, he is Professor of Bioinformatics at Oslo University Hospital and the University of Oslo in Norway. He received a Ph.D. in computational solid-state physics from the University of East Anglia, in 1991 and served as a Lecturer at the Dept of Physics in the University of Texas before working as a Research Fellow at the McDermott Centre for Human Growth and Development, University of Texas Southwestern Medical Centre at Dallas (UTSW)...
December 23, 2022: FEBS Open Bio
https://read.qxmd.com/read/36548916/first-report-of-pothos-latent-virus-infecting-upland-cotton-gossypium-hirsutum-in-the-united-states
#37
JOURNAL ARTICLE
Nina Aboughanem-Sabanadzovic, Tom Allen, Jodi Scheffler, Sead Sabanadzovic
Pothos latent virus (PoLV) is a virus with isometric virions and a positive-sense RNA genome, approximately 4.4 kb in size, currently classified in the genus Aureusvirus, family Tombusviridae (Martelli et al. 1998; Rubino et al. 1995). After its original discovery from hydroponic-grown pothos plants (Scindapsus aureus) in Italy (Sabanadzovic et al. 1995), additional PoLV isolates were reported from pigeonpea (Cajanus cajan) and lisianthus (Eustoma grandiflorum) in India and Taiwan, respectively (Chen et al...
December 22, 2022: Plant Disease
https://read.qxmd.com/read/36519006/evaluating-dry-vs-wet-disinfection-in-boot-baths-on-detection-of-porcine-epidemic-diarrhea-virus-and-porcine-reproductive-and-respiratory-virus-rna
#38
JOURNAL ARTICLE
Olivia L Harrison, Grace E Houston, Allison K Blomme, Haley K Otott, Jianfa Bai, Elizabeth G Poulsen Porter, Jason C Woodworth, Chad B Paulk, Jordan T Gebhardt, Cassandra K Jones
Maintaining biosecurity between swine barns is challenging, and boot baths are an easily implementable option some utilize to limit pathogen spread. However, there are concerns regarding their efficacy, especially when comparing wet or dry disinfectants. The objective of this study was to evaluate the efficacy of boot baths in reducing the quantity of detectable porcine epidemic diarrhea virus ( PEDV ) and porcine reproductive and respiratory syndrome virus ( PRRSV ) genetic material using wet or dry disinfectants...
October 2022: Translational Animal Science
https://read.qxmd.com/read/36495443/guidance-on-processing-the-10x-genomics-single-cell-gene-expression-assay
#39
JOURNAL ARTICLE
Katharina Danielski
The demand for technologies that allow the study of gene expression at single cell resolution continues to increase. One such assay was launched in 2016 by the US-based company 10x Genomics Inc. Utilizing the power of the single cell on a large scale (Zheng et al. Nat Commun 8:14049, 2017)-capturing thousands of cells at once-has shaped life sciences ever since and allowed researchers to discover new insights within their respective fields of study such as oncology, neurobiology, and immunology (among others)...
2023: Methods in Molecular Biology
https://read.qxmd.com/read/36484391/-corrigendum-lncrna-dq786243-promotes-hepatocellular-carcinoma-cell-invasion-and-proliferation-by-regulating-the-mir%C3%A2-15b%C3%A2-5p-wnt3a-axis
#40
Zewei Lin, Jikui Liu
Following the publication of this article, an interested reader drew to the authors' attention that the primer sequences written for lncRNA DQ786243 and miR‑15b‑5p on p. 2 in the study were incorrect. Upon requesting an explanation of these errors from the authors, they realized that, regarding the sequence of the reverse primer for lncRNA DQ786243, three nucleotides were omitted from its 3'‑end [the sequence of this primer on p. 2, right‑hand column, line 25 should have been written as 5'‑CTTCTGCTGGGCTGTTGAGTG‑3' (with the omitted nucleotides highlighted in bold)]...
February 2023: Molecular Medicine Reports
keyword
keyword
76948
2
3
Fetch more papers »
Fetching more papers... Fetching...
Remove bar
Read by QxMD icon Read
×

Save your favorite articles in one place with a free QxMD account.

×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"

We want to hear from doctors like you!

Take a second to answer a survey question.