Read by QxMD icon Read


Andrzej Grzywacz, Dominika Wyborska, Marcin Piwczyński
In forensic entomology practice, species identification is a prerequisite for any further analysis of collected material. Although morphology-based taxonomy may be hindered by a range of factors, these are not obstacles for a molecular identification approach, so-called DNA barcoding. The Fanniidae are a dipteran family that is attracted to and breeds in decomposing animal carrion and dead human bodies. However, morphological identification of fanniids, both at adult and immature stages, is considered to be difficult, particularly for non-experts...
June 29, 2017: Forensic Science International
Eun Hye Kim, Hwan Young Lee, So Yeun Kwon, Eun Young Lee, Woo Ick Yang, Kyoung-Jin Shin
As DNA databases continue to grow and international cooperation increases, forensic STR loci have expanded to increase the discriminatory power and inter-database compatibility. Current capillary electrophoresis (CE) and/or massively parallel sequencing (MPS)-based commercial STR analysis systems reflect such changing trends of expanding STR loci. Due to the general gains of larger multiplexing and the detection of sequence variation, the application of MPS technology to STR analysis has further improved discrimination and is expected to aid in mixture interpretation by increasing the effective number of alleles...
July 9, 2017: Forensic Science International. Genetics
Maria Augusta Dario, Ricardo Moratelli Mendonça da Rocha, Philipp Schwabl, Ana Maria Jansen, Martin S Llewellyn
BACKGROUND: Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonosis. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail. METHODOLOGY/PRINCIPAL FINDINGS: Total DNA was extracted from the blood of 90 bat individuals (17 species) captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil...
July 20, 2017: PLoS Neglected Tropical Diseases
Jeanett Vera, Marcelo H Gutiérrez, Götz Palfner, Silvio Pantoja
Our study reports the diversity of culturable mycoplankton in the eastern South Pacific Ocean off Chile to contribute with novel knowledge on taxonomy of filamentous fungi isolated from distinct physicochemical and biological marine environments. We characterized spatial distribution of isolates, evaluated their viability and assessed the influence of organic substrate availability on fungal development. Thirty-nine Operational Taxonomic Units were identified from 99 fungal strains isolated from coastal and oceanic waters by using Automatic Barcode Gap Discovery...
August 2017: World Journal of Microbiology & Biotechnology
David S Thaler, Mark Y Stoeckle
DNA barcodes for species identification and the analysis of human mitochondrial variation have developed as independent fields even though both are based on sequences from animal mitochondria. This study finds questions within each field that can be addressed by reference to the other. DNA barcodes are based on a 648-bp segment of the mitochondrially encoded cytochrome oxidase I. From most species, this segment is the only sequence available. It is impossible to know whether it fairly represents overall mitochondrial variation...
October 2016: Ecology and Evolution
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
Sylvain Sutour, Hélène Esselin, Ange Bighelli, Joseph Casanova, Line Le Gall, Félix Tomi
Generic and specific determination among the Laurencia complex is a challenging task. DNA barcoding combined with phenotypic investigations are mandatory for species differentiation. In this study, two morphologically different members of the Laurencia complex were investigated using untargeted (1) H NMR-based metabolomics. Twenty-one population samples were collected in order to evaluate both temporal and geographical homogeneity. Data obtained from (1) H NMR analysis followed by statistical analysis allowed a clear separation of all the samples into two groups...
July 19, 2017: Chemistry & Biodiversity
Nicholas L P Andrews, Travis Ferguson, Alana M M Rangaswamy, Adam Bernicky, Niklas Henning, Alexander Dudelzak, Oliver Reich, Jack A Barnes, Hans-Peter Loock
We present a fluorescence excitation emission spectrometer with superior data acquisition rates over previous instruments. White light from a white light emitting diode (LED) source is dispersed onto a digital micromirror array (DMA) and encoded using binary n-size Walsh functions ("barcodes"). The encoded excitation light is used to irradiate the liquid sample and its fluorescence is dispersed and detected using a conventional array spectrometer. After exposure to excitation light encoded in n different ways, the 2-dimensional EEM spectrum is obtained by inverse Hadamard transformation...
July 18, 2017: Analytical Chemistry
Ian G Brennan, Aaron M Bauer, Ngo Van Tri, Yun-Yu Wang, Wen-Zhi Wang, Ya-Ping Zhang, Robert W Murphy
Over the past decade, DNA barcoding has become a staple of low-cost molecular systematic investigations. The availability of universal primers and subsidized sequencing projects (PolarBOL, SharkBOL, SpongeBOL) have driven this popularity, often without appropriate investigation into the utility of barcoding data for the taxonomic group of interest. Here, our primary aim is to determine the phylogenetic value of DNA barcoding (mitochondrial locus COI) within the gecko genus Cyrtodactylus. With >40 new species described since last systematic investigation, Cyrtodactylus represents one of the most diverse extant squamate genera, and their contemporary distribution spans the Indian subcontinent, eastward through Indochina, and into AustraloPapua...
July 17, 2017: Scientific Reports
Daniel H Janzen, John M Burns, Qian Cong, Winnie Hallwachs, Tanya Dapkey, Ramya Manjunath, Mehrdad Hajibabaei, Paul D N Hebert, Nick V Grishin
DNA sequencing brings another dimension to exploration of biodiversity, and large-scale mitochondrial DNA cytochrome oxidase I barcoding has exposed many potential new cryptic species. Here, we add complete nuclear genome sequencing to DNA barcoding, ecological distribution, natural history, and subtleties of adult color pattern and size to show that a widespread neotropical skipper butterfly known as Udranomia kikkawai (Weeks) comprises three different species in Costa Rica. Full-length barcodes obtained from all three century-old Venezuelan syntypes of U...
July 17, 2017: Proceedings of the National Academy of Sciences of the United States of America
Vanina Guernier, Kathryn J Allan, Cyrille Goarant
Leptospirosis is a zoonotic bacterial disease of global importance. A large spectrum of asymptomatic animal hosts can carry the infection and contribute to the burden of human disease. Environmental sources of human contamination also point to the importance of a hydrotelluric reservoir. Leptospirosis can be caused by as many as 15 different pathogenic or intermediate Leptospira species. However, classification of these bacteria remains complicated through the use of both serological and genetic classification systems that show poor correlation...
July 18, 2017: Parasitology
Noah Spies, Ziming Weng, Alex Bishara, Jennifer McDaniel, David Catoe, Justin M Zook, Marc Salit, Robert B West, Serafim Batzoglou, Arend Sidow
In read cloud approaches, microfluidic partitioning of long genomic DNA fragments and barcoding of shorter fragments derived from these fragments retains long-range information in short sequencing reads. This combination of short reads with long-range information represents a powerful alternative to single-molecule long-read sequencing. We develop Genome-wide Reconstruction of Complex Structural Variants (GROC-SVs) for SV detection and assembly from read cloud data and apply this method to Illumina-sequenced 10x Genomics sarcoma and breast cancer data sets...
July 17, 2017: Nature Methods
Jaipal S Choudhary, Naiyar Naaz, Moanaro Lemtur, Bikash Das, Arun Kumar Singh, Bhagwati P Bhatt, Chandra S Prabhakar
The peach fruit fly, Bactrocera zonata, is among the most serious and polyphagous insect pest of fruit crops in many parts of the world under genus Bactrocera. In the present study, the genetic structure, diversity and demographic history of B. zonata in India were inferred from mitochondrial cytochrome oxidase 1 (cox1) and NADH dehydrogenase 1 (nad1) sequences. The efficiency of DNA barcodes for identification of B. zonata was also tested. Genetic diversity indices [number of haplotypes (H), haplotype diversity (Hd), nucleotide diversity (π) and average number of nucleotide differences (k)] of B...
July 15, 2017: Mitochondrial DNA. Part A. DNA Mapping, Sequencing, and Analysis
Zheng Liang Wang, Xiao Qing Yang, Tian Zhao Wang, Xiaoping Yu
DNA barcoding has been widely used to identify and discover new species in a wide range of taxa. In order to assess the effectiveness of COI (cytochrome C oxidase subunit I) and 16S (16S ribosomal RNA) in the discrimination of spiders, we have generated 289 barcodes for a total of 56 farmland spider species from 14 different families for the first time in China. Our results reveal that the standard barcoding marker COI can be used to distinguish the farmland spiders both in species and family level by NJ tree-based method, despite the absence of a barcode gap between the intra- and inter-specific genetic divergences...
July 15, 2017: Mitochondrial DNA. Part A. DNA Mapping, Sequencing, and Analysis
Konrad Celiński, Hanna Kijak, Aleksandra Wojnicka-Półtorak, Katarzyna Buczkowska-Chmielewska, Joanna Sokołowska, Ewa Chudzińska
DNA barcoding is a standard and efficient method, frequently used for identification, discrimination and discovery of new species. Although this approach is very useful for classifying the world's biodiversity, little is known about its usefulness in barcoding at lower taxonomic level and its discrimination rate for closely related species, like conifers. In this study, we compared the genetic variation of eight chloroplast DNA barcode regions (matK, rbcL, trnH-psbA, trnL-trnF, rpl20-rps18, trnV, ycf1, ycf2) in 17 conifers - three closely related pines from Pinus mugo complex and 14 more distant conifers representing two genera and four sections of the Pinaceae family...
July 12, 2017: Comptes Rendus Biologies
Wesley F Reinhart, Jeff G Reifenberger, Damini Gupta, Abhiram Muralidhar, Julian Sheats, Han Cao, Kevin D Dorfman
No abstract text is available yet for this article.
July 14, 2017: Journal of Chemical Physics
Kerstin Cornils, Lars Thielecke, Doreen Winkelmann, Tim Aranyossy, Mathias Lesche, Andreas Dahl, Ingo Roeder, Boris Fehse, Ingmar Glauche
BACKGROUND: Clonal competition in cancer describes the process in which the progeny of a cell clone supersedes or succumbs to other competing clones due to differences in their functional characteristics, mostly based on subsequently acquired mutations. Even though the patterns of those mutations are well explored in many tumors, the dynamical process of clonal selection is underexposed. METHODS: We studied the dynamics of clonal competition in a BcrAbl-induced leukemia using a γ-retroviral vector library encoding the oncogene in conjunction with genetic barcodes...
July 14, 2017: Molecular Cancer
Ellen Bushell, Ana Rita Gomes, Theo Sanderson, Burcu Anar, Gareth Girling, Colin Herd, Tom Metcalf, Katarzyna Modrzynska, Frank Schwach, Rowena E Martin, Michael W Mather, Geoffrey I McFadden, Leopold Parts, Gavin G Rutledge, Akhil B Vaidya, Kai Wengelnik, Julian C Rayner, Oliver Billker
The genomes of malaria parasites contain many genes of unknown function. To assist drug development through the identification of essential genes and pathways, we have measured competitive growth rates in mice of 2,578 barcoded Plasmodium berghei knockout mutants, representing >50% of the genome, and created a phenotype database. At a single stage of its complex life cycle, P. berghei requires two-thirds of genes for optimal growth, the highest proportion reported from any organism and a probable consequence of functional optimization necessitated by genomic reductions during the evolution of parasitism...
July 13, 2017: Cell
Thomas P Wyche, René F Ramos Alvarenga, Jeff S Piotrowski, Megan N Duster, Simone R Warrack, Gabriel Cornilescu, Travis J De Wolfe, Yanpeng Hou, Doug R Braun, Gregory A Ellis, Scott W Simpkins, Justin Nelson, Chad L Myers, James Steele, Hirotada Mori, Nasia Safdar, John L Markley, Scott Raymond Rajski, Tim S Bugni
A polyether antibiotic, ecteinamycin (1) was isolated from a marine Actinomadura sp., cultivated from the ascidian Ectein-ascidia turbinata. 13C-enrichment, high resolution NMR spectroscopy and molecular modeling enabled elucidation of the structure of 1 which was validated on the basis of comparisons with its recently reported crystal structure. Importantly, ec-teinamycin demonstrated potent activity against the toxigenic strain of Clostridium difficile NAP1/B1/027 (MIC = 59 ng/μL), as well as other toxigenic and non-toxigenic C...
July 14, 2017: ACS Chemical Biology
Yao A Kolombia, Gerrit Karssen, Nicole Viaene, P Lava Kumar, Nancy de Sutter, Lisa Joos, Danny L Coyne, Wim Bert
The root-knot nematodes (RKN), Meloidogyne spp., represent an important threat to yam (Dioscorea spp.) production in West Africa. With the aim to establish the diversity of RKN species affecting yam tubers, for control and resistance screening purposes, surveys were conducted in the main yam producing areas of Nigeria. Galled tubers (N = 48) were collected from farmers' stores and markets in nine states in Nigeria and in one district in Ghana. RKN isolated from yam tubers were identified using enzyme phenotyping (esterase and malate dehydrogenase) and mitochondrial DNA (mtDNA) NADH dehydrogenase subunit 5 (Nad5) barcoding...
June 2017: Journal of Nematology
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"