keyword
MENU ▼
Read by QxMD icon Read
search

Natural health

keyword
https://www.readbyqxmd.com/read/28728139/a-longitudinal-analysis-of-the-influence-of-the-neighborhood-environment-on-recreational-walking-within-the-neighborhood-results-from-reside
#1
Hayley Christian, Matthew Knuiman, Mark Divitini, Sarah Foster, Paula Hooper, Bryan Boruff, Fiona Bull, Billie Giles-Corti
BACKGROUND: There is limited longitudinal evidence confirming the role of neighborhood environment attributes in encouraging people to walk more or if active people simply choose to live in activity-friendly neighborhoods. Natural experiments of policy changes to create more walkable communities provide stronger evidence for a causal effect of neighborhood environments on residents' walking. OBJECTIVES: We aimed to investigate longitudinal associations between objective and perceived neighborhood environment measures and neighborhood recreational walking...
July 12, 2017: Environmental Health Perspectives
https://www.readbyqxmd.com/read/28727621/how-information-drives-complexity
#2
Thomas R Clancy
As systems evolve over time, their natural tendency is to become increasingly more complex. Studies in the field of complex systems have generated new perspectives on the application of management strategies in health systems. This article is the 2nd in a series of articles that focuses on why technological complexity is increasing and strategies nurse administrators can use to successfully implement change in the face of it.
July 2017: Journal of Nursing Administration
https://www.readbyqxmd.com/read/28727536/1918-influenza-pandemic-in-utero-exposure-in-the-united-states-and-long-term-impact-on-hospitalizations
#3
Joseph Kofi Acquah, Roshani Dahal, Frank A Sloan
OBJECTIVES: To explore associations between in utero exposure to the 1918 influenza pandemic and hospitalization rates in old age (≥ 70 years) in the United States. METHODS: We identified individuals exposed (mild and deadly waves) and unexposed in utero to the 1918 influenza pandemic (a natural experiment) by using birth dates from the Asset and Health Dynamics Among the Oldest Old survey. We analyzed differences in hospitalization rates by exposure status with multivariate linear regression...
July 20, 2017: American Journal of Public Health
https://www.readbyqxmd.com/read/28727521/ethical-guidance-for-disaster-response-specifically-around-crisis-standards-of-care-a-systematic-review
#4
Jonathon P Leider, Debra DeBruin, Nicole Reynolds, Angelica Koch, Judy Seaberg
BACKGROUND: Terrorism, disease outbreaks, and other natural disasters and mass casualty events have pushed health care and public health systems to identify and refine emergency preparedness protocols for disaster response. Ethical guidance, alongside legal and medical frameworks, are increasingly common components of disaster response plans. OBJECTIVES: To systematically review the prevalence and content of ethical guidance offered for disaster response, specifically around crisis standards of care (CSCs)...
July 20, 2017: American Journal of Public Health
https://www.readbyqxmd.com/read/28727183/a-randomised-controlled-trial-on-a-nurse-led-smartphone-based-self-management-programme-for-patients-with-poorly-controlled-type-2-diabetes-a-study-protocol
#5
Wenru Wang, Betsy Seah, Ying Jiang, Violeta Lopez, Cherry Tan, Suan Tee Lim, Hongliang Ren, Yin Hao Khoo
AIM: To develop and compare a nurse-led smartphone-based self-management programme with an existing nurse-led diabetes service on health-related outcomes for patients with poorly controlled type 2 diabetes in Singapore. BACKGROUND: Over the past decades, Asia has emerged as the 'diabetes epicentre' in the world due to rapid economic development, urbanisation and nutrition transition. There is an urgent need to develop more effective care management strategies in response to this rising diabetes epidemic...
July 20, 2017: Journal of Advanced Nursing
https://www.readbyqxmd.com/read/28726958/wasabia-japonica-is-a-potential-functional-food-to-prevent-colitis-via-inhibiting-the-nf-%C3%AE%C2%BAb-signaling-pathway
#6
Ju-Hee Kang, Seungho Choi, Jeong-Eun Jang, Prakash Ramalingam, Young Tag Ko, Sun Yeou Kim, Seung Hyun Oh
Inflammatory bowel diseases (IBDs), including Crohn's disease (CD) and ulcerative colitis (UC), are prevalent and debilitating health problems worldwide. Many types of drugs are used to treat IBDs, but they exhibit adverse effects such as vomiting, nausea, abdominal pain, diarrhea, etc. In order to overcome the limitations of current therapeutic drugs, scientists have searched for functional foods from natural resources. In this study, we investigated the anti-colitic effects of Wasabia japonica extract in a DSS-induced colitis model...
July 20, 2017: Food & Function
https://www.readbyqxmd.com/read/28726530/incremental-net-monetary-benefit-of-ocrelizumab-relative-to-subcutaneous-interferon-%C3%AE-1a
#7
Melissa A Frasco, Tiffany Shih, Devin Incerti, Oliver Diaz Espinosa, Diana K Vania, Nina Thomas
AIM: Disease-modifying therapies (DMTs) impact the natural history of relapsing forms of multiple sclerosis (RRMS) by reducing annual relapse rates and slowing disability progression. The effect of DMTs on indirect costs has not been consistently explored in cost-effectiveness studies thus far. The value to patients of an emerging DMT, ocrelizumab, was quantified in comparison to subcutaneous interferon beta-1a (IFNβSC) for the prevalent RRMS population with mild to moderate disability in the United States based on two Phase 3 trials, OPERA I and OPERA II, of ocrelizumab versus IFNβSC in RRMS...
July 20, 2017: Journal of Medical Economics
https://www.readbyqxmd.com/read/28726273/epigallocatechin-gallate-enhances-treatment-efficacy-of-oral-nifedipine-against-pregnancy-induced-severe-pre-eclampsia-a-double-blind-randomized-and-placebo-controlled-clinical-study
#8
D-D Shi, J-J Guo, L Zhou, N Wang
WHAT IS KNOWN AND OBJECTIVE: Oral nifedipine is commonly used to treat pre-eclampsia, one of the most severe complications during pregnancy, but its clinical efficacy is less than ideal. Epigallocatechin gallate (EGCG), a natural compound from green tea, could benefit cardiovascular health especially hypertension. We investigated the clinical efficacy of EGCG, when complemented with oral nifedipine, in treating pre-eclampsia. METHODS: A total of 350 pregnant women with severe pre-eclampsia were recruited and randomized to receive oral nifedipine, together with placebo (NIF+placebo) or EGCG (NIF+EGCG)...
July 20, 2017: Journal of Clinical Pharmacy and Therapeutics
https://www.readbyqxmd.com/read/28725928/structural-modification-of-cuminaldehyde-thiosemicarbazone-increases-inhibition-specificity-toward-aflatoxin-biosynthesis-and-sclerotia-development-in-aspergillus-flavus
#9
Francesca Degola, Franco Bisceglie, Marianna Pioli, Sabrina Palmano, Lisa Elviri, Giorgio Pelosi, Tiziana Lodi, Francesco Maria Restivo
Aspergillus flavus is an opportunistic mold that represents a serious threat for human and animal health due to its ability to synthesize and release, on food and feed commodities, different toxic secondary metabolites. Among them, aflatoxin B1 is one of the most dangerous since it is provided with a strong cancerogenic and mutagenic activity. Controlling fungal contamination on the different crops that may host A. flavus is considered a priority by sanitary authorities of an increasing number of countries due also to the fact that, owing to global temperature increase, the geographic areas that are expected to be prone to experience sudden A...
July 19, 2017: Applied Microbiology and Biotechnology
https://www.readbyqxmd.com/read/28725600/endogenous-and-exogenous-testosterone-and-prostate-cancer-decreased-increased-or-null-risk
#10
REVIEW
David S Lopez, Shailesh Advani, Konstantinos K Tsilidis, Run Wang, Steven Canfield
For more than 70 years, the contention that high levels of testosterone or that the use of testosterone therapy (TTh) increases the development and progression of prostate cancer (PCa) has been widely accepted and practiced. Yet, the increasing and emerging evidence on testosterone research seems to challenge that contention. To review literature on the associations of endogenous and exogenous testosterone with decreased-, increased-, or null-risk of PCa, and to further evaluate only those studies that reported magnitude of associations from multivariable modeling as it minimizes confounding effects...
June 2017: Translational Andrology and Urology
https://www.readbyqxmd.com/read/28724955/mushroom-lectin-overcomes-hepatitis-b-virus-tolerance-via-tlr6-signaling
#11
Meina He, Dan Su, Qinghong Liu, Wenjuan Gao, Youmin Kang
Currently, chronic hepatitis B virus (HBV) infection remains a serious public health problem in the world. Recombinant HBV vaccine, as a preventive strategy against HBV infection, generates high antibody level, but it is not effective to activate innate and cellular immunity for chronic HBV infection therapy. Lectins from mushroom are natural and active proteins which have been shown important biological functions. However, little is known about the immunological mechanism engaged by mushroom lectins. Here we report that, lectin from Pleurotus ostreatus (POL) stimulated innate response by activating Toll-like receptor 6 signal pathway of dendritic cells...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#12
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28724420/legal-access-to-medications-a-threat-to-brazil-s-public-health-system
#13
Ana Luiza Chieffi, Rita De Cassia Barata Barradas, Moisés Golbaum
BACKGROUND: In Brazil, health is fundamental human right guaranteed by the Constitution of 1988, which created the Brazilian Universal Health System (Sistema Único de Saúde - SUS). The SUS provides medications for outpatient care via policy of pharmaceutical assistance (PA) programmes. Despite the advances in PA policies which include the improvement in access to medications, there has been a significant increase in lawsuits related to health products and services. This study aimed to characterize the medication processes filed between 2010 and 2014 against the Secretary of State for Health of São Paulo (State Health Department of São Paulo - SES/SP), in Brazil, following PA policies...
July 19, 2017: BMC Health Services Research
https://www.readbyqxmd.com/read/28724193/saline-irrigation-for-the-management-of-skin-extravasation-injury-in-neonates
#14
REVIEW
P N Gopalakrishnan, Nitin Goel, Sujoy Banerjee
BACKGROUND: Extravasation injury, a complication commonly seen in the neonatal intensive care unit, can result in scarring with cosmetic and functional sequelae. A wide variety of treatments are available, including subcutaneous irrigation with saline (with or without hyaluronidase), liposuction, use of specific antidotes, topical applications, and normal wound care with dry or wet dressings. All such treatments aim to prevent or reduce the severity of complications. OBJECTIVES: Primary objective To compare the efficacy and safety of saline irrigation or saline irrigation with prior hyaluronidase infiltration versus no intervention or normal wound care for tissue healing in neonates with extravasation injury...
July 19, 2017: Cochrane Database of Systematic Reviews
https://www.readbyqxmd.com/read/28724020/the-home-care-teaching-and-learning-process-in-undergraduate-health-care-degree-courses
#15
Ana Paula Hermann, Maria Ribeiro Lacerda, Mariluci Alves Maftum, Elizabeth Bernardino, Ana Lúcia Schaefer Ferreira de Mello
Home care, one of the services provided by the health system, requires health practitioners who are capable of understanding its specificities. This study aimed to build a substantive theory that describes experiences of home care teaching and learning during undergraduate degree courses in nursing, pharmacy, medicine, nutrition, dentistry and occupational therapy. A qualitative analysis was performed using the grounded theory approach based on the results of 63 semistructured interviews conducted with final year students, professors who taught subjects related to home care, and recent graduates working with home care, all participants in the above courses...
July 2017: Ciência & Saúde Coletiva
https://www.readbyqxmd.com/read/28724015/anti-bullying-interventions-in-schools-a-systematic-literature-review
#16
Jorge Luiz da Silva, Wanderlei Abadio de Oliveira, Flávia Carvalho Malta de Mello, Luciane Sá de Andrade, Marina Rezende Bazon, Marta Angélica Iossi Silva
This paper presents a systematic literature review addressing rigorously planned and assessed interventions intended to reduce school bullying. The search for papers was performed in four databases (Lilacs, Psycinfo, Scielo and Web of Science) and guided by the question: What are the interventions used to reduce bullying in schools? Only case-control studies specifically focusing on school bullying without a time frame were included. The methodological quality of investigations was assessed using the SIGN checklist...
July 2017: Ciência & Saúde Coletiva
https://www.readbyqxmd.com/read/28724001/food-marketing-targeting-children-unveiling-the-ethical-perspectives-in-the-discourse-on-self-regulation
#17
Dillian Adelaine Cesar da Silva, Antonio Carlos Rodrigues da Cunha, Thiago Rocha da Cunha, Caroline Filla Rosaneli
When it comes to food marketing, children are one of the major targets. Regulatory actions can play a strategic role in health protection. The objective of this research was to characterize the ethical perspective in the discourse against state regulatory actions on food marketing directed at children, aiming to understand the context of the discourse's production and how it creates meaning. The methodology adopted was qualitative, with documentary analysis and use of concepts and procedures from Discourse Analysis...
July 2017: Ciência & Saúde Coletiva
https://www.readbyqxmd.com/read/28723956/psychosis-risk-research-versus-daily-prognosis-uncertainties-a-qualitative-study-of-french-youth-psychiatrists-attitudes-toward-predictive-practices
#18
Laelia Benoit, Marie Rose Moro, Bruno Falissard, Nicolas Henckes
BACKGROUND: Over the last twenty years, predicting psychosis has become a priority of both research and policies. Those approaches include the use of the At Risk Mental State category (ARMS) and of standardized predictive tools. In comparison to most developed countries, early interventions programs are only little developed in France. However, cases of young patients presenting unclear symptoms that might be a beginning psychosis or might as well reflect some adolescent unease are commonplace in psychiatry...
2017: PloS One
https://www.readbyqxmd.com/read/28723939/assessing-health-related-resiliency-in-hiv-latin-women-preliminary-psychometric-findings
#19
Gladys J Jimenez-Torres, Valerie Wojna, Ernesto Rosario, Rosa Hechevarría, Ada M Alemán-Batista, Miriam Ríos Matos, Alok Madan, Richard L Skolasky, Summer F Acevedo
BACKGROUND: HIV-associated vulnerabilities-especially those linked to psychological issues-and limited mental health-treatment resources have the potential to adversely affect the health statuses of individuals. The concept of resilience has been introduced in the literature to shift the emphasis from vulnerability to protective factors. Resilience, however, is an evolving construct and is measured in various ways, though rarely among underserved, minority populations. Herein, we present the preliminary psychometric properties of a sample of HIV-seropositive Puerto Rican women, measured using a newly developed health-related resilience scale...
2017: PloS One
https://www.readbyqxmd.com/read/28723811/the-afya-bora-fellowship-an-innovative-program-focused-on-creating-an-interprofessional-network-of-leaders-in-global-health
#20
Wendy M Green, Carey Farquhar, Yohana Mashalla
PROBLEM: Most current health professions education programs are focused on the development of clinical skills. As a result, they may not address the complex and interconnected nature of global health. Trainees require relevant clinical, programmatic, and leadership skills to meet the challenges of practicing in an increasingly globalized environment. APPROACH: To develop health care leaders within sub-Saharan Africa, the Afya Bora Consortium developed a one-year fellowship for medical doctors and nurses...
July 18, 2017: Academic Medicine: Journal of the Association of American Medical Colleges
keyword
keyword
71386
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"