keyword
MENU ▼
Read by QxMD icon Read
search

detective medicine

keyword
https://www.readbyqxmd.com/read/28728382/effects-of-a-traditional-chinese-medicine-formula-and-its-extraction-on-muscle-fiber-characteristics-in-finishing-pigs-porcine-cell-proliferation-and-isoforms-of-myosin-heavy-chain-gene-expression-in-myocytes
#1
Qin Ping Yu, Ding Yuan Feng, Xiao Jun He, Fan Wu, Min Hao Xia, Tao Dong, Yi Hua Liu, Hui Ze Tan, Shi Geng Zou, Tao Zheng, Xian Hua Ou, Jian Jun Zou
Objective: This study evaluated the effects of a traditional Chinese medicine formula (TCMF) on muscle fiber characteristics in finishing pigs and the effects of the formula's extract (distilled water, ethyl acetate and petroleum ether extraction) on porcine cell proliferation and isoforms of MyHC gene expression in myocytes. Methods: XThe psoas major muscle was obtained from pigs at the end of the experiment. Muscle fiber characteristics in the psoas major muscle were analyzed using myosin ATPase staining...
June 26, 2017: Asian-Australasian Journal of Animal Sciences
https://www.readbyqxmd.com/read/28728265/-mass-spectrometry-combined-with-gene-analysis-for-prenatal-diagnosis-of-glutaric-acidemia-type-%C3%A2
#2
F Han, L S Han, W J Ji, T Chen, F Xu, Y Wang, J Ye, W J Qiu, H W Zhang, Y Z Jiang, C Hou, X F Gu
Objective: To investigate the value of amniotic fluid metabolite detection by mass spectrometry combined with gene mutation analysis in the prenatal diagnosis of glutaric acidemia type Ⅰ (GA-Ⅰ). Method: From January 2009 to December 2016, Department of Pediatric Endocrinology and Genetic, Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine carried out prenatal diagnosis for 24 cases of pregnant women with GA-Ⅰproband. 24 pregnant women without organic acidemia proband for conventional prenatal diagnosis at the same period were used as the control group...
July 2, 2017: Zhonghua Er Ke za Zhi. Chinese Journal of Pediatrics
https://www.readbyqxmd.com/read/28728067/an-optimized-hplc-uv-method-for-quantitatively-determining-sesquiterpenes-in-nardostachyos-radix-et-rhizoma
#3
Vu Ngoc Han Le, Trong Quan Khong, Min Kyun Na, Kyung Tae Kim, Jong Seong Kang
Nardostachyos Radix et Rhizoma (NR), the root and rhizome from either Nardostachys jatamansi Batal or Nardostachys jatamansi DC, is known to have biological functions including neuro-protective and anti-pancreatitis activity. The main bioactive compounds within NR are all classified as sesquiterpenes, and include desoxo-narchinol A, nardosinonediol, and nardosinone. Although NR is a valuable herb that is widely used in many Asian countries, robust quality control protocols for NR are still in question, especially those that can analyze the three main active compounds...
July 8, 2017: Journal of Pharmaceutical and Biomedical Analysis
https://www.readbyqxmd.com/read/28727969/fetal-dysmorphology-still-an-essential-art-analysis-of-the-limitations-of-microarray-in-a-fetal-population-and-a-look-toward-the-genome-sequencing-era
#4
E Fletcher, M Porteous, K J McKenzie, E J Maher, M J Evans
Cytogenomic microarray allows assessment of the genome at higher resolutions than traditional karyotyping. The objective of this study is to evaluate the utility of microarray in a routine fetal autopsy setting before the advent of routine fetal exome/genome sequencing and the issues these technologies may generate. A systematic review of fetal postmortems at 12-24 weeks gestation between January 2011 and December 2014 was undertaken. Cases where there was no consent for audit, research, or genetic testing were excluded as were cases referred to the Procurator Fiscal, stillbirths, and neonatal deaths...
July 2017: Pediatric and Developmental Pathology
https://www.readbyqxmd.com/read/28727125/usefulness-of-saline-infusion-sonohysterography-and-feeding-artery-imaging-in-endometrial-polyp-diagnosis
#5
Marcin Anioł, Grażyna Dec, Katarzyna Wojda, Piotr Sieroszewski
OBJECTIVES: The aim of this study was to assess the usefulness of sonohysterography with feeding artery visualization using transvaginal sonography to diagnose endometrial polyps. MATERIAL AND METHODS: We conducted an observational study of 60 perimenopausal patients referred to the Department of Fetal Medicine and Gynaecology, Medical University of Lodz with abnormal uterine bleeding or suspicion of endometrial pathology based on sonography scan. In all 60 patients transvaginal sonography scan showed a possibility of an endometrial polyp...
2017: Ginekologia Polska
https://www.readbyqxmd.com/read/28726968/evaluation-of-spectral-photon-counting-computed-tomography-k-edge-imaging-for-determination-of-gold-nanoparticle-biodistribution-in-vivo
#6
Salim Si-Mohamed, David P Cormode, Daniel Bar-Ness, Monica Sigovan, Pratap C Naha, Jean-Baptiste Langlois, Lara Chalabreysse, Philippe Coulon, Ira Blevis, Ewald Roessl, Klaus Erhard, Loic Boussel, Philippe Douek
Spectral photon counting computed tomography (SPCCT) is an emerging medical imaging technology. SPCCT scanners record the energy of incident photons, which allows specific detection of contrast agents due to measurement of their characteristic X-ray attenuation profiles. This approach is known as K-edge imaging. Nanoparticles formed from elements such as gold, bismuth or ytterbium have been reported as potential contrast agents for SPCCT imaging. Furthermore, gold nanoparticles have many applications in medicine, such as adjuvants for radiotherapy and photothermal ablation...
July 20, 2017: Nanoscale
https://www.readbyqxmd.com/read/28726757/characterization-of-essential-oil-composition-in-different-basil-species-and-pot-cultures-by-a-gc-ms-method
#7
Andrea Muráriková, Anton Ťažký, Jarmila Neugebauerová, Alexandra Planková, Josef Jampílek, Pavel Mučaji, Peter Mikuš
Basil (Ocimum L.) species are used as medicinal plants due to their essential oils exhibiting specific biological activity. The present work demonstrated that both the variety and season/conditions of cultivation had a significant effect on (i) the produced amount (extraction yield), (ii) qualitative, as well as (iii) quantitative profile of basil essential oil. Among studied basil varieties, a new variety, 'Mánes', was characterized for the first time. Based on our quantitative evaluation of GC-MS profiles, the following chemotypes and average concentrations of a main component were detected in the studied basil varieties: 'Ohře', 'Lettuce Leaf', 'Purple Opaal', 'Dark Green' (linalool, 5...
July 20, 2017: Molecules: a Journal of Synthetic Chemistry and Natural Product Chemistry
https://www.readbyqxmd.com/read/28725632/medicinal-importance-pharmacological-activities-and-analytical-aspects-of-hispidulin-a-concise-report
#8
REVIEW
Kanika Patel, Dinesh Kumar Patel
Herbal medicines have been played an important role in the human civilization since very ancient time as a food, cloth, medicine and other aspects. Some of the important drugs in the modern medicine were derived from the natural sources such as aspirin, digitalis, quinine, vincristine, vinblastine etc. Hispidulin (4', 5, 7-trihydroxy-6-methoxyflavone) is a flavones derivative found in plant such as Grindelia argentina, Arrabidaea chica, Saussurea involucrate, Crossostephium chinense, Artemisia and Salvia species...
July 2017: Journal of Traditional and Complementary Medicine
https://www.readbyqxmd.com/read/28725622/authentication-of-piper-betle-l-folium-and-quantification-of-their-antifungal-activity
#9
I Made Agus Gelgel Wirasuta, I Gusti Ayu Made Srinadi, Ida Bagus Gede Dwidasmara, Ni Luh Putu Putri Ardiyanti, I Gusti Ayu Arya Trisnadewi, Ni Luh Putu Vidya Paramita
The TLC profiles of intra- and inter-day precision for Piper betle L. (PBL) folium methanol extract was studied for their peak marker recognition and identification. The Numerical chromatographic parameters (NCPs) of the peak markers, the hierarchical clustering analysis (HCA) and the principal component analysis (PCA) were applied to authenticate the PBL. folium extract from other Piper species folium extract and to ensure the antifungal activity quality of the PBL essential oil. The spotted extract was developed with the mobile phase of toluene: ethyl acetate; 93:7, (v/v)...
July 2017: Journal of Traditional and Complementary Medicine
https://www.readbyqxmd.com/read/28725346/diagnosing-allergic-sensitizations-in-the-third-millennium-why-clinicians-should-know-allergen-molecule-structures
#10
REVIEW
C Alessandri, R Ferrara, M L Bernardi, D Zennaro, L Tuppo, I Giangrieco, M Tamburrini, A Mari, M A Ciardiello
Diagnostic tests to detect allergic sensitization were introduced at the end of the nineteenth century but only in the late 1990s did the advent of molecular allergology revolutionize the approach to the allergic patient. Personalized Medicine, a medical procedure that separates patients into different groups with different medical decisions, practices and interventions has sanctioned this change. In fact, in the last few years molecular allergology and the observation that not every patient has the same allergic profile, even when allergic to the same allergenic source, has originated the concept "one size does not fit all"...
2017: Clinical and Translational Allergy
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#11
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28723715/novel-weight-based-dose-threshold-for-18f-naf-pet-ct-imaging-using-advanced-pet-ct-systems-a-potential-tool-for-reducing-radiation-burden
#12
Fahad Marafi, Abdulreda Esmail, Rashid Rasheed, Fareeda Alkandari, Sharjeel Usmani
BACKGROUND: Fluorine-18-sodium fluoride (F-NaF) PET/CT is an important tool for detecting and evaluating metastatic bone cancer. Besides traditional dose metrics, recent methods such as real-time dose mapping, dose calculation from DICOM information, and their relevance to entrance skin exposure are currently in use to reduce the radiation burden. In this study, we have analyzed the data of 1062 patients retrospectively to evaluate patterns of absorbed dose for institutional weight-based dose protocol as compared with fixed dose method guidelines of Society of Nuclear Medicine and Molecular Imaging (SNMMI)...
July 18, 2017: Nuclear Medicine Communications
https://www.readbyqxmd.com/read/28723287/advanced-renal-cell-carcinoma-role-of-the-radiologist-in-the-era-of-precision-medicine
#13
Atul B Shinagare, Katherine M Krajewski, Marta Braschi-Amirfarzan, Nikhil H Ramaiya
For the past decade, advanced renal cell carcinoma (RCC) has been at the forefront of oncologic innovation. Our rapidly evolving understanding of the molecular and genetic basis of RCC has revolutionized the management of advanced RCC; 10 novel molecular targeted agents and immune checkpoint inhibitor have received U.S. Food and Drug Administration approval for treatment of advanced RCC in a little over a decade. Amid this progress, imaging has assumed a central role in metastatic surveillance and follow-up of advanced RCC...
August 2017: Radiology
https://www.readbyqxmd.com/read/28723215/discrimination-cascade-enabled-selective-detection-of-single-nucleotide-mutation
#14
Lidan Li, Xianjin Xiao, Jingyang Ge, Manli Han, Xu Zhou, Lei Wang, Xin Su, Changyuan Yu
Owing to the significance of single nucleotide mutation (SNM) for personalized medicine, the detection of SNM with high accuracy has recently attracted considerable interest. Here, we present a kinetic method for selective detection of SNM based on a discrimination cascade constructed by combining the toehold strand displacement (TSD) and endonuclease IV (Endo IV) catalyzed hydrolysis. The single-nucleotide specificity of the two DNA reactions allows highly selective detection of all types of single nucleotide changes (including single-nucleotide insertion and deletion), achieving a high discrimination factor with a median of 491 which is comparable with recently reported methods...
March 24, 2017: ACS Sensors
https://www.readbyqxmd.com/read/28723188/salt-gradient-improving-signal-to-noise-ratio-in-solid-state-nanopore
#15
Jingjie Sha, Hongjiao Shi, Yin Zhang, Chen Chen, Lei Liu, Yunfei Chen
As the single molecule detection tool, solid-state nanopores are being applied in more and more fields, such as medicine controlled delivery, ion conductance microscopes, nanosensors, and DNA sequencing. The critical information obtained from nanopores is the signal collected, which is the ionic block current caused by the molecules passing through the pores. However, the information collected is, in part, impeded by the relatively low signal-to-noise ratio of the current solid-state nanopore measurements. Here, we report that using a salt gradient across the nanopore could improve the signal-to-noise ratio when molecules translocate through Si3N4 nanopore...
April 28, 2017: ACS Sensors
https://www.readbyqxmd.com/read/28722637/schistosomiasis-in-european-travelers-and-migrants-analysis-of-14-years-tropnet-surveillance-data
#16
Tilman Lingscheid, Florian Kurth, Jan Clerinx, Stefania Marocco, Begoña Trevino, Mirjam Schunk, José Muñoz, Ida E Gjørup, Tomas Jelinek, Michel Develoux, Graham Fry, Thomas Jänisch, Matthias L Schmid, Olivier Bouchaud, Sabino Puente, Lorenzo Zammarchi, Kristine Mørch, Anders Björkman, Heli Siikamäki, Andreas Neumayr, Henrik Nielsen, Urban Hellgren, Malgorzata Paul, Guido Calleri, Pavel Kosina, Bjørn Myrvang, José M Ramos, Gudrun Just-Nübling, Anna Beltrame, José Saraiva da Cunha, Peter Kern, Laurence Rochat, August Stich, Peter Pongratz, Martin P Grobusch, Norbert Suttorp, Martin Witzenrath, Christoph Hatz, Thomas Zoller, TropNet Schistosomiasis Investigator Group
Schistosomiasis remains one of the most prevalent parasitic diseases worldwide and the infection is frequently found in travelers and migrants. The European Network for Tropical Medicine and Travel Health conducted a sentinel surveillance study on imported schistosomiasis between 1997 and 2010. This report summarizes epidemiological and clinical data from 1,465 cases of imported schistosomiasis. Direct pathogen detection and serology were the main diagnostic tools applied. Of these, 486 (33%) cases were identified among European travelers, 231 (16%) among long-term expatriates, and 748 (51%) among non-European immigrants...
May 30, 2017: American Journal of Tropical Medicine and Hygiene
https://www.readbyqxmd.com/read/28722604/classification-and-visualization-of-physical-and-chemical-properties-of-falsified-medicines-with-handheld-raman-spectroscopy-and-x-ray-computed-tomography
#17
Tomoko Kakio, Naoko Yoshida, Susan Macha, Kazunobu Moriguchi, Takashi Hiroshima, Yukihiro Ikeda, Hirohito Tsuboi, Kazuko Kimura
Analytical methods for the detection of substandard and falsified medical products (SFs) are important for public health and patient safety. Research to understand how the physical and chemical properties of SFs can be most effectively applied to distinguish the SFs from authentic products has not yet been investigated enough. Here, we investigated the usefulness of two analytical methods, handheld Raman spectroscopy (handheld Raman) and X-ray computed tomography (X-ray CT), for detecting SFs among oral solid antihypertensive pharmaceutical products containing candesartan cilexetil as an active pharmaceutical ingredient (API)...
June 19, 2017: American Journal of Tropical Medicine and Hygiene
https://www.readbyqxmd.com/read/28722267/simultaneous-bright-and-black-blood-whole-heart-mri-for-noncontrast-enhanced-coronary-lumen-and-thrombus-visualization
#18
Giulia Ginami, Radhouene Neji, Alkystis Phinikaridou, John Whitaker, René M Botnar, Claudia Prieto
PURPOSE: To develop a 3D whole-heart Bright-blood and black-blOOd phase SensiTive (BOOST) inversion recovery sequence for simultaneous noncontrast enhanced coronary lumen and thrombus/hemorrhage visualization. METHODS: The proposed sequence alternates the acquisition of two bright-blood datasets preceded by different preparatory pulses to obtain variations in blood/myocardium contrast, which then are combined in a phase-sensitive inversion recovery (PSIR)-like reconstruction to obtain a third, coregistered, black-blood dataset...
July 19, 2017: Magnetic Resonance in Medicine: Official Journal of the Society of Magnetic Resonance in Medicine
https://www.readbyqxmd.com/read/28722095/-correlation-of-mri-apparent-diffusion-coeffcient-with-molecular-marker-ki-67-in-gastric-cancer
#19
Guodian Zheng, Xiangdong Cheng, Lijing Wang, Zhiyuan Xu, Xuning Gao, Pengfei Yu, Hang Lyu, Ting Huang, Jiahui Chen
OBJECTIVES: To study the correlation between MRI apparent diffusion coefficient (ADC) and expression of Ki-67 in gastric cancers, and to investigate the application of ADC value in diagnosing the malignance of gastric cancer. METHODS: A retrospective cohort analysis was performed on 87 gastric cancer patients who received MRI examination and radical resection at Zhejiang Provincial Hospital of Traditional Chinese Medicine from November 2014 to August 2015. All the postoperative resected samples were confirmed as gastric cancer...
July 25, 2017: Zhonghua Wei Chang Wai Ke za Zhi, Chinese Journal of Gastrointestinal Surgery
https://www.readbyqxmd.com/read/28722078/true-prevalence-of-copd-and-its-association-with-peripheral-arterial-disease-in-the-internal-medicine-ward-of-a-tertiary-care-hospital
#20
Jonathan Tschopp, Philippe Dumont, Daniel Hayoz
OBJECTIVES: The primary objective was to determine the prevalence of confirmed chronic obstructive pulmonary disease (COPD) in patients aged 45 years or more who were admitted to the internal medicine ward of our tertiary care hospital (HFR Fribourg, Switzerland), and were either "tagged" as having COPD or at risk for COPD. The secondary objective was to determine the prevalence of the association of COPD with peripheral artery disease (PAD) in this population. METHODOLOGY: We evaluated all consecutive patients aged 45 years, admitted to our internal medicine ward between November 2013 and March 2014...
July 19, 2017: Swiss Medical Weekly
keyword
keyword
6414
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"