keyword
MENU ▼
Read by QxMD icon Read
search

snp height

keyword
https://www.readbyqxmd.com/read/28812414/adipokine-genes-and-radiographic-hand-osteoarthritis-in-finnish-women-a-cross-sectional-study
#1
S Hämäläinen, S Solovieva, T Vehmas, A Hirvonen, P Leino-Arjas
OBJECTIVES: Available evidence suggests that genetic factors and overweight play major roles in the aetiology of osteoarthritis (OA). We analysed the association of 18 single-nucleotide polymorphisms (SNPs) from nine adipokine and adipokine receptor genes (LEP, LEPR, ADIPOQ, RETN, NAMPT, SERPINA12, ITLN1, RARRES2, and APLN) with radiographic hand OA. METHOD: The study design was cross-sectional. Bilateral hand radiographs of 542 occupationally active Finnish female dentists and teachers aged 45-63 years were examined and classified for the presence of hand OA using reference images...
August 16, 2017: Scandinavian Journal of Rheumatology
https://www.readbyqxmd.com/read/28806927/mapping-of-a-major-qtl-for-salt-tolerance-of-mature-field-grown-maize-plants-based-on-snp-markers
#2
Meijie Luo, Yanxin Zhao, Ruyang Zhang, Jinfeng Xing, Minxiao Duan, Jingna Li, Naishun Wang, Wenguang Wang, Shasha Zhang, Zhihui Chen, Huasheng Zhang, Zi Shi, Wei Song, Jiuran Zhao
BACKGROUND: Salt stress significantly restricts plant growth and production. Maize is an important food and economic crop but is also a salt sensitive crop. Identification of the genetic architecture controlling salt tolerance facilitates breeders to select salt tolerant lines. However, the critical quantitative trait loci (QTLs) responsible for the salt tolerance of field-grown maize plants are still unknown. RESULTS: To map the main genetic factors contributing to salt tolerance in mature maize, a double haploid population (240 individuals) and 1317 single nucleotide polymorphism (SNP) markers were employed to produce a genetic linkage map covering 1462...
August 15, 2017: BMC Plant Biology
https://www.readbyqxmd.com/read/28793914/performance-of-gout-definitions-for-genetic-epidemiological-studies-analysis-of-uk-biobank
#3
Murray Cadzow, Tony R Merriman, Nicola Dalbeth
BACKGROUND: Many different combinations of available data have been used to identify gout cases in large genetic studies. The aim of this study was to determine the performance of case definitions of gout using the limited items available in multipurpose cohorts for population-based genetic studies. METHODS: This research was conducted using the UK Biobank Resource. Data, including genome-wide genotypes, were available for 105,421 European participants aged 40-69 years without kidney disease...
August 9, 2017: Arthritis Research & Therapy
https://www.readbyqxmd.com/read/28769955/genome-wide-association-study-reveals-candidate-genes-for-control-of-plant-height-branch-initiation-height-and-branch-number-in-rapeseed-brassica-napus-l
#4
Ming Zheng, Cheng Peng, Hongfang Liu, Min Tang, Hongli Yang, Xiaokang Li, Jinglin Liu, Xingchao Sun, Xinfa Wang, Junfeng Xu, Wei Hua, Hanzhong Wang
Plant architecture is crucial for rapeseed yield and is determined by plant height (PH), branch initiation height (BIH), branch number (BN) and leaf and inflorescence morphology. In this study, we measured three major factors (PH, BIH, and BN) in a panel of 333 rapeseed accessions across 4 years. A genome-wide association study (GWAS) was performed via Q + K model and the panel was genotyped using the 60 k Brassica Infinium SNP array. We identified seven loci for PH, four for BIH, and five for BN. Subsequently, by determining linkage disequilibrium (LD) decay associated with 38 significant SNPs, we gained 31, 15, and 17 candidate genes for these traits, respectively...
2017: Frontiers in Plant Science
https://www.readbyqxmd.com/read/28744006/association-of-human-height-related-genetic-variants-with-familial-short-stature-in-han-chinese-in-taiwan
#5
Ying-Ju Lin, Wen-Ling Liao, Chung-Hsing Wang, Li-Ping Tsai, Chih-Hsin Tang, Chien-Hsiun Chen, Jer-Yuarn Wu, Wen-Miin Liang, Ai-Ru Hsieh, Chi-Fung Cheng, Jin-Hua Chen, Wen-Kuei Chien, Ting-Hsu Lin, Chia-Ming Wu, Chiu-Chu Liao, Shao-Mei Huang, Fuu-Jen Tsai
Human height can be described as a classical and inherited trait model. Genome-wide association studies (GWAS) have revealed susceptible loci and provided insights into the polygenic nature of human height. Familial short stature (FSS) represents a suitable trait for investigating short stature genetics because disease associations with short stature have been ruled out in this case. In addition, FSS is caused only by genetically inherited factors. In this study, we explored the correlations of FSS risk with the genetic loci associated with human height in previous GWAS, alone and cumulatively...
July 25, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28724990/large-meta-analysis-of-genome-wide-association-studies-identifies-five-loci-for-lean-body-mass
#6
M Carola Zillikens, Serkalem Demissie, Yi-Hsiang Hsu, Laura M Yerges-Armstrong, Wen-Chi Chou, Lisette Stolk, Gregory Livshits, Linda Broer, Toby Johnson, Daniel L Koller, Zoltán Kutalik, Jian'an Luan, Ida Malkin, Janina S Ried, Albert V Smith, Gudmar Thorleifsson, Liesbeth Vandenput, Jing Hua Zhao, Weihua Zhang, Ali Aghdassi, Kristina Åkesson, Najaf Amin, Leslie J Baier, Inês Barroso, David A Bennett, Lars Bertram, Rainer Biffar, Murielle Bochud, Michael Boehnke, Ingrid B Borecki, Aron S Buchman, Liisa Byberg, Harry Campbell, Natalia Campos Obanda, Jane A Cauley, Peggy M Cawthon, Henna Cederberg, Zhao Chen, Nam H Cho, Hyung Jin Choi, Melina Claussnitzer, Francis Collins, Steven R Cummings, Philip L De Jager, Ilja Demuth, Rosalie A M Dhonukshe-Rutten, Luda Diatchenko, Gudny Eiriksdottir, Anke W Enneman, Mike Erdos, Johan G Eriksson, Joel Eriksson, Karol Estrada, Daniel S Evans, Mary F Feitosa, Mao Fu, Melissa Garcia, Christian Gieger, Thomas Girke, Nicole L Glazer, Harald Grallert, Jagvir Grewal, Bok-Ghee Han, Robert L Hanson, Caroline Hayward, Albert Hofman, Eric P Hoffman, Georg Homuth, Wen-Chi Hsueh, Monica J Hubal, Alan Hubbard, Kim M Huffman, Lise B Husted, Thomas Illig, Erik Ingelsson, Till Ittermann, John-Olov Jansson, Joanne M Jordan, Antti Jula, Magnus Karlsson, Kay-Tee Khaw, Tuomas O Kilpeläinen, Norman Klopp, Jacqueline S L Kloth, Heikki A Koistinen, William E Kraus, Stephen Kritchevsky, Teemu Kuulasmaa, Johanna Kuusisto, Markku Laakso, Jari Lahti, Thomas Lang, Bente L Langdahl, Lenore J Launer, Jong-Young Lee, Markus M Lerch, Joshua R Lewis, Lars Lind, Cecilia Lindgren, Yongmei Liu, Tian Liu, Youfang Liu, Östen Ljunggren, Mattias Lorentzon, Robert N Luben, William Maixner, Fiona E McGuigan, Carolina Medina-Gomez, Thomas Meitinger, Håkan Melhus, Dan Mellström, Simon Melov, Karl Michaëlsson, Braxton D Mitchell, Andrew P Morris, Leif Mosekilde, Anne Newman, Carrie M Nielson, Jeffrey R O'Connell, Ben A Oostra, Eric S Orwoll, Aarno Palotie, Stephan Parker, Munro Peacock, Markus Perola, Annette Peters, Ozren Polasek, Richard L Prince, Katri Räikkönen, Stuart H Ralston, Samuli Ripatti, John A Robbins, Jerome I Rotter, Igor Rudan, Veikko Salomaa, Suzanne Satterfield, Eric E Schadt, Sabine Schipf, Laura Scott, Joban Sehmi, Jian Shen, Chan Soo Shin, Gunnar Sigurdsson, Shad Smith, Nicole Soranzo, Alena Stančáková, Elisabeth Steinhagen-Thiessen, Elizabeth A Streeten, Unnur Styrkarsdottir, Karin M A Swart, Sian-Tsung Tan, Mark A Tarnopolsky, Patricia Thompson, Cynthia A Thomson, Unnur Thorsteinsdottir, Emmi Tikkanen, Gregory J Tranah, Jaakko Tuomilehto, Natasja M van Schoor, Arjun Verma, Peter Vollenweider, Henry Völzke, Jean Wactawski-Wende, Mark Walker, Michael N Weedon, Ryan Welch, H-Erich Wichman, Elisabeth Widen, Frances M K Williams, James F Wilson, Nicole C Wright, Weijia Xie, Lei Yu, Yanhua Zhou, John C Chambers, Angela Döring, Cornelia M van Duijn, Michael J Econs, Vilmundur Gudnason, Jaspal S Kooner, Bruce M Psaty, Timothy D Spector, Kari Stefansson, Fernando Rivadeneira, André G Uitterlinden, Nicholas J Wareham, Vicky Ossowski, Dawn Waterworth, Ruth J F Loos, David Karasik, Tamara B Harris, Claes Ohlsson, Douglas P Kiel
Lean body mass, consisting mostly of skeletal muscle, is important for healthy aging. We performed a genome-wide association study for whole body (20 cohorts of European ancestry with n = 38,292) and appendicular (arms and legs) lean body mass (n = 28,330) measured using dual energy X-ray absorptiometry or bioelectrical impedance analysis, adjusted for sex, age, height, and fat mass. Twenty-one single-nucleotide polymorphisms were significantly associated with lean body mass either genome wide (p < 5 × 10(-8)) or suggestively genome wide (p < 2...
July 19, 2017: Nature Communications
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#7
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28712975/fto-genotype-and-weight-status-among-preadolescents-assessing-the-mediating-effects-of-obesogenic-appetitive-traits
#8
Jennifer A Emond, Alison Tovar, Zhigang Li, Reina K Lansigan, Diane Gilbert-Diamond
Polymorphisms in the Fat Mass and Obesity Associated (FTO) gene are robustly associated with overweight and obesity among children, although the underlying mechanisms are poorly understood. We tested if appetitive traits partially mediated the association between FTO genotype and increased BMI among a sample of US preadolescents. Data were from 178 unrelated 9-10 year olds who participated in an experimental study between 2013 and 2015. Children's DNA was isolated from buccal swabs, and the rs9939609 SNP in the FTO gene was genotyped...
October 1, 2017: Appetite
https://www.readbyqxmd.com/read/28703288/a-comparative-proteomic-analysis-of-blood-serum-for-developmental-stages-in-pigs
#9
K Srikanth, E Lee, A Kwon, J Shin, H Chung
This study aimed to differentiate genes at developmental stages of pigs from 0 to 150 days of age, to build up a protein database and to find candidate genetic markers for growth traits. The analysis of two-dimensional electrophoresis and matrix-assisted laser-desorption/ionization mass spectrometry separated 252 protein segments. After successfully blasting the peptide sequences, the analysis confirmed 37 differentially expressed proteins that increased from birth to 150 days of age (type A), whereas the type B proteins presented the inverse pattern...
July 12, 2017: Animal Genetics
https://www.readbyqxmd.com/read/28680808/sequence-motifs-capable-of-forming-dna-stem-loop-structures-act-as-a-replication-diode
#10
Andrey Shirak, Uri Seroussi, Elisha Gootwine, Eyal Seroussi
Calculating peak-height ratios between single-nucleotide polymorphisms (SNP) alleles in sequencing chromatograms is a practical method for estimating their copy number proportions (CNPs). However, it is surprising that sequencing DNA from different directions might yield different results. We analyzed three adjacent SNPs within the ovine period circadian-clock 2 (PER2) gene that displayed such behavior. We compared Sanger and DNA-seq sequencing for this locus and applied high-resolution melt and MFOLD analyses to point to the DNA secondary structure that underlined this phenomenon...
July 2017: FEBS Open Bio
https://www.readbyqxmd.com/read/28640125/targeted-sequencing-in-fgf-fgfr-genes-and-association-analysis-of-variants-for-mandibular-prognathism
#11
Xueyan Xiong, Shuyuan Li, Ying Cai, Fengshan Chen
To identify variants of the genes in fibroblast growth factors/fibroblast growth factor receptors (FGF/FGFR) signal pathway that predispose to mandibular prognathism (MP) in the general Chinese population systematically.Targeted sequencing of the FGF/FGFR genes was conducted in 176 MP individuals and 155 class I malocclusion controls. The associations of common and rare variants with MP as a categorical phenotype and also continuous malocclusion phenotypes generated by principal component (PC) analysis were analyzed...
June 2017: Medicine (Baltimore)
https://www.readbyqxmd.com/read/28601624/age-at-menarche-and-cardiovascular-risk-factors-using-mendelian-randomization-in-the-guangzhou-biobank-cohort-study
#12
Shiu Lun Au Yeung, Chaoqiang Jiang, Kar Keung Cheng, Lin Xu, Weisen Zhang, Tai Hing Lam, Gabriel Matthew Leung, C Mary Schooling
Observational studies show earlier age at menarche associated with higher risk of cardiovascular disease although these studies could be confounded by childhood obesity or childhood socioeconomic position. We tested the hypothesis that earlier age at menarche is associated with poorer cardiovascular risk factors using a Mendelian randomization design. We conducted a Mendelian randomization study in a large Southern Chinese cohort, the Guangzhou Biobank Cohort Study (n=12,279), to clarify the causal role of menarche in cardiovascular disease risk factors including blood pressure, lipids, fasting glucose, adiposity and type 2 diabetes...
August 2017: Preventive Medicine
https://www.readbyqxmd.com/read/28592497/increased-power-to-dissect-adaptive-traits-in-global-sorghum-diversity-using-a-nested-association-mapping-population
#13
Sophie Bouchet, Marcus O Olatoye, Sandeep R Marla, Ramasamy Perumal, Tesfaye Tesso, Jianming Yu, Mitch Tuinstra, Geoffrey P Morris
Adaptation of domesticated species to diverse agroclimatic regions has led to abundant trait diversity. However, the resulting population structure and genetic heterogeneity confounds association mapping of adaptive traits. To address this challenge in sorghum [Sorghum bicolor (L.) Moench]-a widely adapted cereal crop-we developed a nested association mapping (NAM) population using 10 diverse global lines crossed with an elite reference line RTx430. We characterized the population of 2214 recombinant inbred lines at 90,000 SNPs using genotyping-by-sequencing...
June 2017: Genetics
https://www.readbyqxmd.com/read/28588384/snp-based-association-analysis-for-seedling-traits-in-durum-wheat-triticum-turgidum-l-durum-desf
#14
Salih A I Sabiel, Sisi Huang, Xin Hu, Xifeng Ren, Chunjie Fu, Junhua Peng, Dongfa Sun
In the present study, 150 accessions of worldwide originated durum wheat germplasm (Triticum turgidum spp. durum) were observed for major seedling traits and their growth. The accessions were evaluated for major seedling traits under controlled conditions of hydroponics at the 13(th), 20(th), 27(th) and 34(th) day-after germination. Biomass traits were measured at the 34(th) day-after germination. Correlation analysis was conducted among the seedling traits and three field traits at maturity, plant height, grain weight and 1000-grain weight observed in four consecutive years...
March 2017: Breeding Science
https://www.readbyqxmd.com/read/28564656/association-study-of-three-gene-polymorphisms-recently-identified-by-a-genome-wide-association-study-with-obesity-related-phenotypes-in-chinese-children
#15
Qi-Ying Song, Jie-Yun Song, Yang Wang, Shuo Wang, Yi-De Yang, Xiang-Rui Meng, Jun Ma, Hai-Jun Wang, Yan Wang
OBJECTIVE: This study aimed to examine associations of three single-nucleotide polymorphisms (SNPs) with obesity-related phenotypes in Chinese children. These SNPs were identified by a recent genome-wide association (GWA) study among European children. Given that varied genetic backgrounds across different ethnicity may result in different association, it is necessary to study these associations in a different ethnic population. METHODS: A total of 3,922 children, including 2,191 normal-weight, 873 overweight and 858 obese children, from three independent studies were included in the study...
2017: Obesity Facts
https://www.readbyqxmd.com/read/28559908/association-of-candidate-genes-with-submergence-response-in-perennial-ryegrass
#16
Xicheng Wang, Yiwei Jiang, Xiongwei Zhao, Xin Song, Xiangye Xiao, Zhongyou Pei, Huifen Liu
Perennial ryegrass is a popular cool-season grass species due to its high quality for forage and turf. The objective of this study was to identify associations of candidate genes with growth and physiological traits to submergence stress and recovery after de-submergence in a global collection of 94 perennial ryegrass accessions. Accessions varied largely in leaf color, plant height (HT), leaf fresh weight (LFW), leaf dry weight (LDW), and chlorophyll fluorescence (Fv/Fm) at 7 days of submergence and in HT, LFW and LDW at 7 days of recovery in two experiments...
2017: Frontiers in Plant Science
https://www.readbyqxmd.com/read/28547737/08sg2-osbak1-regulates-grain-size-and-number-and-functions-differently-in-indica-and-japonica-backgrounds-in-rice
#17
Hua Yuan, Shijun Fan, Juan Huang, Shijie Zhan, Shifu Wang, Peng Gao, Weilan Chen, Bin Tu, Bingtian Ma, Yuping Wang, Peng Qin, Shigui Li
BACKGROUND: Both grain size and grain number are significant for rice yield. In the past decade, a number of genes related to grain size and grain number have been documented, however, the regulatory mechanisms underlying them remains ambiguous. RESULTS: We identified a rice small grain (sg2) mutant in an EMS mutant library generated from an indica variety, Shuhui498. Using the MutMap gene mapping strategy, we identified two linkage regions on chromosome 7 and 8, respectively, consistent with the segregation ratios in the F2 population...
December 2017: Rice
https://www.readbyqxmd.com/read/28533785/qtl-mapping-for-yield-and-resistance-against-mediterranean-corn-borer-in-maize
#18
José C Jiménez-Galindo, Bernardo Ordás, Ana Butrón, Luis F Samayoa, Rosa A Malvar
Introduction: The Mediterranean corn borer (MCB), Sesamia nonagrioides, is a major pest of maize, Zea mays, in Mediterranean countries, inflicting significant kernel yield losses. For that reason, it necessary to know the genetic mechanisms that regulate the agronomic and resistance traits. A quantitative trait loci (QTL) mapping study for yield, resistance against MCB attack, and other relevant agronomic traits was performed using a recombinant inbred line (RIL) population derived from the cross A637 × A509 that is expected to segregate for yield, and ear, and stalk resistance to MCB...
2017: Frontiers in Plant Science
https://www.readbyqxmd.com/read/28518213/relationship-between-toll-like-receptor-2-r753q-and-t16934a-polymorphisms-and-staphylococcus-aureus-nasal-carriage
#19
Maciej Żukowski, Olga Taryma-Leśniak, Mariusz Kaczmarczyk, Katarzyna Kotfis, Łukasz Szydłowski, Andrzej Ciechanowicz, Mirosław Brykczyński, Agnieszka Żukowska
BACKGROUND: The association among specific single-nucleotide polymorphisms (SNPs) in TLR2 R753Q (rs5743708) and T16934A (rs4696480) and the nasal carriage of Staphylococcus aureus was studied in adults before CABG. METHODS: The TLR2 polymorphisms were genotyped in 299 consecutive patients prepared for a CABG operation. Genotyping was performed using restriction fragment length polymorphism (RFLP) analysis of PCR-amplified fragments. Two nasal swab cultures were taken within 2 weeks before the operation...
May 18, 2017: Anaesthesiology Intensive Therapy
https://www.readbyqxmd.com/read/28483360/regulation-of-growth-epigenetic-mechanisms
#20
Laurent Kappeler, Maud Clemessy, Sarah Saget, Lyvianne Decourtye, Yves Le Bouc
Organism development is controlled by both genetic programs and the environment to insure a reproductive success as adults. Linear growth is an important part of the development and is mostly controlled by genetic factors. However, the variability of height in a given species does not seem to be specifically associated with SNP. This suggests that environment may play a crucial role. In agreement, an important part of height-related genes present CpG island in their proximal promoter, indicating potential involvement of epigenetic mechanisms...
May 5, 2017: Annales D'endocrinologie
keyword
keyword
4671
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"