keyword
MENU ▼
Read by QxMD icon Read
search

Profit

keyword
https://www.readbyqxmd.com/read/28731547/does-hospital-ownership-influence-hospital-referral-region-health-rankings-in-the-united-states
#1
Hanadi Hamadi, Emma Apatu, Aaron Spaulding
Extensive evidence demonstrates that a hospital's organizational ownership structure impacts its overall performance, but little is known concerning the influence of hospital structure on the health of its community. This paper explores the association between US hospital referral region (HRR) health rankings and hospital ownership and performance. Data from the 2016 Commonwealth Fund Scorecard on Local Health System Performance, the American Hospital Association dataset, and the Hospital Value-Based Purchasing dataset are utilized to conduct a cross-sectional analysis of 36 quality measures across 306 HRRs...
July 21, 2017: International Journal of Health Planning and Management
https://www.readbyqxmd.com/read/28730062/challenges-faced-by-women-with-disabilities-in-accessing-sexual-and-reproductive-health-in-zimbabwe-the-case-of-chitungwiza-town
#2
Tafadzwa Rugoho, France Maphosa
BACKGROUND: Women with disabilities in Zimbabwe face numerous challenges in accessing sexual and reproductive health. Cultural belief still regards them as not sexually active. The government has also failed to promote policies that facilitate access to sexual and reproductive services by women with disabilities. OBJECTIVES: The reseach objectives were to explore the challenges faced by women with disabilities in accessing sexual and reproductive health in Zimbabwe...
2017: Afr J Disabil
https://www.readbyqxmd.com/read/28728971/a-multi-objective-optimization-approach-for-the-selection-of-working-fluids-of-geothermal-facilities-economic-environmental-and-social-aspects
#3
Juan Martínez-Gomez, Javier Peña-Lamas, Mariano Martín, José María Ponce-Ortega
The selection of the working fluid for Organic Rankine Cycles has traditionally been addressed from systematic heuristic methods, which perform a characterization and prior selection considering mainly one objective, thus avoiding a selection considering simultaneously the objectives related to sustainability and safety. The objective of this work is to propose a methodology for the optimal selection of the working fluid for Organic Rankine Cycles. The model is presented as a multi-objective approach, which simultaneously considers the economic, environmental and safety aspects...
July 17, 2017: Journal of Environmental Management
https://www.readbyqxmd.com/read/28728899/machine-learning-enabled-discovery-and-design-of-membrane-active-peptides
#4
Ernest Y Lee, Gerard C L Wong, Andrew L Ferguson
Antimicrobial peptides are a class of membrane-active peptides that form a critical component of innate host immunity and possess a diversity of sequence and structure. Machine learning approaches have been profitably employed to efficiently screen sequence space and guide experiment towards promising candidates with high putative activity. In this mini-review, we provide an introduction to antimicrobial peptides and summarize recent advances in machine learning-enabled antimicrobial peptide discovery and design with a focus on a recent work Lee et al...
July 8, 2017: Bioorganic & Medicinal Chemistry
https://www.readbyqxmd.com/read/28728808/wolves-in-sheep-s-clothing-is-non-profit-status-used-to-signal-quality
#5
Daniel B Jones, Carol Propper, Sarah Smith
Why do many firms in the healthcare sector adopt non-profit status? One argument is that non-profit status serves as a signal of quality when consumers are not well informed. A testable implication is that an increase in consumer information may lead to a reduction in the number of non-profits in a market. We test this idea empirically by exploiting an exogenous increase in consumer information in the US nursing home industry. We find that the information shock led to a reduction in the share of non-profit homes, driven by a combination of home closure and sector switching...
July 1, 2017: Journal of Health Economics
https://www.readbyqxmd.com/read/28728401/research-trends-in-outdoor-pig-production
#6
Hyun-Suk Park, Sang Hyon Oh
Since the industrialization of swine production in the late 1900s, swine farms in the United States, as well as in Europe, have largely become consolidated. Pig farms became larger in size but fewer in number, with 91% of market pigs being produced by large operations with 5,000 or more pigs on-site in the US, and only 3% of the total utilized agricultural land representing organic farming. Such change in the market made it difficult for small farmers to stay competitive, forcing them to find alternative ways to reduce the cost of production and increase profit using the outdoor production system...
July 17, 2017: Asian-Australasian Journal of Animal Sciences
https://www.readbyqxmd.com/read/28727120/economic-selection-indexes-for-hereford-and-braford-cattle-raised-in-southern-brazil
#7
R F Costa, B B M Teixeira, M J Yokoo, F F Cardoso
Economic selection indexes (EI) are considered the best way to select the most profitable animals for specific production systems. Nevertheless, in Brazil, few genetic evaluation programs deliver such indexes to their breeders. The aims of this study were to determine the breeding goals (BG) and economic values (EV, in US$) for typical beef cattle production systems in southern Brazil, to propose EI aimed to maximize profitability, and to compare the proposed EI with the currently used empirical index. Bioeconomic models were developed to characterize 3 typical production systems, identifying traits of economic impact and their respective EV...
July 2017: Journal of Animal Science
https://www.readbyqxmd.com/read/28727111/phenotypic-and-genetic-relationships-of-residual-feed-intake-measures-and-their-component-traits-with-fatty-acid-composition-in-subcutaneous-adipose-of-beef-cattle
#8
F Zhang, C Ekine-Dzivenu, M Vinsky, J A Basarab, J L Aalhus, M E R Dugan, C Li
Feed efficiency is of particular interest to the beef industry because feed is the largest variable cost in production and fatty acid composition is emerging as an important trait, both economically and socially, due to the potential implications of dietary fatty acids on human health. Quantifying correlations between feed efficiency and fatty acid composition will contribute to construction of optimal multiple-trait selection indexes to maximize beef production profitability. In the present study, we estimated phenotypic and genetic correlations of feed efficiency measures including residual feed intake (RFI), RFI adjusted for final ultrasound backfat thickness (RFIf); their component traits ADG, DMI, and metabolic BW; and final ultrasound backfat thickness measured at the end of feedlot test with 25 major fatty acids in the subcutaneous adipose tissues of 1,366 finishing steers and heifers using bivariate animal models...
July 2017: Journal of Animal Science
https://www.readbyqxmd.com/read/28726989/economic-selection-index-development-for-beefmaster-cattle-ii-general-purpose-breeding-objective
#9
K P Ochsner, M D MacNeil, R M Lewis, M L Spangler
An economic selection index was developed for Beefmaster cattle in a general-purpose production system in which bulls are mated to a combination of heifers and mature cows, with resulting progeny retained as replacements or sold at weaning. National average prices from 2010 to 2014 were used to establish income and expenses for the system. Genetic parameters were obtained from the literature. Economic values were estimated by simulating 100,000 animals and approximating the partial derivatives of the profit function by perturbing traits 1 at a time, by 1 unit, while holding the other traits constant at their respective means...
May 2017: Journal of Animal Science
https://www.readbyqxmd.com/read/28726706/cost-assessment-of-different-routes-for-phosphorus-recovery-from-wastewater-using-data-from-pilot-and-production-plants
#10
A Nättorp, K Remmen, C Remy
Phosphorus (P) recovery from wastewater has considerable potential to supplement limited fossil P reserves. Reliable cost data are essential for investor and policymaker decisions. In this study, investment and operational costs for nine P recovery processes were calculated from the investor's perspective, taking into account all relevant side effects on the sludge treatment or the wastewater treatment plant. The assessment was based on pilot and full-scale data which were thoroughly consolidated and standardized with technical and cost data from the German wastewater-sludge treatment train to enable direct comparison...
July 2017: Water Science and Technology: a Journal of the International Association on Water Pollution Research
https://www.readbyqxmd.com/read/28726437/anti-profit-beliefs-how-people-neglect-the-societal-benefits-of-profit
#11
Amit Bhattacharjee, Jason Dana, Jonathan Baron
Profit-seeking firms are stereotypically depicted as immoral and harmful to society. At the same time, profit-driven enterprise has contributed immensely to human prosperity. Though scholars agree that profit can incentivize societally beneficial behaviors, people may neglect this possibility. In 7 studies, we show that people see business profit as necessarily in conflict with social good, a view we call anti-profit beliefs. Studies 1 and 2 demonstrate that U.S. participants hold anti-profit views of real U...
July 20, 2017: Journal of Personality and Social Psychology
https://www.readbyqxmd.com/read/28726015/community-perceptions-of-hospitals-and-shared-physical-space-a-qualitative-study
#12
Daniel Skinner, Berkeley Franz, Kelly Kelleher, Robert Penfold
In addition to providing critical medical services to communities, hospitals are also forces of broader change when seen from the perspective of neighborhood development. Over the past few decades the obligation on the part of U.S. nonprofit hospitals to positively impact the communities in which they are located has become entrenched in both U.S. tax law and the practices of many hospitals. This article presents findings from a grounded theory qualitative study of the relationship between a non-profit children's hospital in Columbus, Ohio, and the neighborhood in which it is located...
July 19, 2017: Culture, Medicine and Psychiatry
https://www.readbyqxmd.com/read/28725147/shortage-of-psychotropic-medications-in-community-pharmacies-in-saudi-arabia-causes-and-solutions
#13
Yazed Sulaiman Al-Ruthia, Wael Mansy, Mohammad Barasin, Yazeed Mohammad Ghawaa, Mohammed AlSultan, Mohammad A Alsenaidy, Solaiman Alhawas, Sultan AlGhadeer
Background: Patients with mental disorders, such as depression and anxiety, who seek medical care in private psychiatric clinics in Riyadh, Saudi Arabia, have recently expressed concerns to doctors about difficulty in filling psychotropic medications, such as Amitriptyline and Aripiprazole, at retail community pharmacies. Objectives: The aim of this study was to investigate whether there is a shortage of some commonly prescribed psychotropic medications in retail community pharmacies in Saudi Arabia, and if so, to explore the possible reasons behind the shortage of these medications...
July 2017: Saudi Pharmaceutical Journal: SPJ: the Official Publication of the Saudi Pharmaceutical Society
https://www.readbyqxmd.com/read/28725118/share-capitalism-and-worker-wellbeing
#14
Alex Bryson, Andrew E Clark, Richard B Freeman, Colin P Green
We show that worker wellbeing is determined not only by the amount of compensation workers receive but also by how compensation is determined. While previous theoretical and empirical work has often been preoccupied with individual performance-related pay, we find that the receipt of a range of group-performance schemes (profit shares, group bonuses and share ownership) is associated with higher job satisfaction. This holds conditional on wage levels, so that pay methods are associated with greater job satisfaction in addition to that coming from higher wages...
October 2016: Labour Economics
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#15
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28724728/global-decline-of-bumblebees-is-phylogenetically-structured-and-inversely-related-to-species-range-size-and-pathogen-incidence
#16
Marina P Arbetman, Gabriela Gleiser, Carolina L Morales, Paul Williams, Marcelo A Aizen
Conservation biology can profit greatly from incorporating a phylogenetic perspective into analyses of patterns and drivers of species extinction risk. We applied such an approach to analyse patterns of bumblebee (Bombus) decline. We assembled a database representing approximately 43% of the circa 260 globally known species, which included species extinction risk assessments following the International Union fo Conservation of Nature Red List categories and criteria, and information on species traits presumably associated with bumblebee decline...
July 26, 2017: Proceedings. Biological Sciences
https://www.readbyqxmd.com/read/28724358/quality-of-care-and-quality-of-life-of-people-with-dementia-living-at-green-care-farms-a-cross-sectional-study
#17
Bram de Boer, Jan P H Hamers, Sandra M G Zwakhalen, Frans E S Tan, Hilde Verbeek
BACKGROUND: Many countries are introducing smaller, more home-like care facilities that represent a radically new approach to nursing home care for people with dementia. The green care farm is a new type of nursing home developed in the Netherlands. The goal of this study was to compare quality of care, quality of life and related outcomes in green care farms, regular small-scale living facilities and traditional nursing homes for people with dementia. METHODS: A cross-sectional design was used...
July 19, 2017: BMC Geriatrics
https://www.readbyqxmd.com/read/28721080/a-cost-analysis-of-a-broad-spectrum-antibiotic-therapy-in-the-empirical-treatment-of-health-care-associated-infections-in-cirrhotic-patients
#18
Cristina Lucidi, Vincenza Di Gregorio, Giancarlo Ceccarelli, Mario Venditti, Oliviero Riggio, Manuela Merli
BACKGROUND: Early diagnosis and appropriate treatment of infections in cirrhosis are crucial. As new guidelines in this context, particularly for health care-associated (HCA) infections, would be needed, we performed a trial documenting whether an empirical broad-spectrum antibiotic therapy is more effective than the standard one for these infections. Because of the higher daily cost of broad-spectrum than standard antibiotics, we performed a cost analysis to compare: 1) total drug costs, 2) profitability of hospital admissions...
2017: ClinicoEconomics and Outcomes Research: CEOR
https://www.readbyqxmd.com/read/28720631/accrued-cost-savings-of-a-free-clinic-using-quality-adjusted-life-years-saved-and-return-on-investment
#19
Jim Sanders, Marcus Lacey, Clare E Guse
INTRODUCTION: Savings garnered through the provision of preventive services is a form of profit for health systems. Free clinics have been using this logic to demonstrate their cost-savings. The Community-Based Chronic Disease Management (CCDM) clinic treats hypertension using nurse-led teams, clinical protocols, and community-based settings. METHODS: We calculated CCDM's cost-effectiveness from 2007 to 2013 using 2 metrics: Quality-adjusted life years (QALYs) saved and return on investment (ROI)...
July 2017: Journal of the American Board of Family Medicine: JABFM
https://www.readbyqxmd.com/read/28720620/in-this-issue-opiates-tobacco-social-determinants-of-health-social-accountability-for-non-profit-hospitals-more-on-pcmh-and-clinical-topics
#20
EDITORIAL
Marjorie A Bowman, Anne Victoria Neale, Dean A Seehusen
This issue contains several articles about the factors contributing to the complex and deadly interplay between social determinants of health, pain, mental illness, and addictive substances such as opioids and tobacco. One article clearly is a call to action: more than half of opioid prescriptions in the United States are given to patients with mental health problems. Two articles report work on the next steps for social determinants of health in health care settings. Social accountability based on community health needs assessments required of community hospitals should lead to the creation of more family medicine residency positions...
July 2017: Journal of the American Board of Family Medicine: JABFM
keyword
keyword
4499
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"