keyword
MENU ▼
Read by QxMD icon Read
search

botanical

keyword
https://www.readbyqxmd.com/read/28731826/convergently-evolved-toxic-secondary-metabolites-in-plants-drive-the-parallel-molecular-evolution-of-insect-resistance
#1
Georg Petschenka, Vera Wagschal, Michael von Tschirnhaus, Alexander Donath, Susanne Dobler
Natural selection imposed by natural toxins has led to striking levels of convergent evolution at the molecular level. Cardiac glycosides represent a group of plant toxins that block the Na,K-ATPase, a vital membrane protein in animals. Several herbivorous insects have convergently evolved resistant Na,K-ATPases, and in some species, convergent gene duplications have also arisen, likely to cope with pleiotropic costs of resistance. To understand the genetic basis and predictability of these adaptations, we studied five independent lineages of leaf-mining flies (Diptera: Agromyzidae)...
August 2017: American Naturalist
https://www.readbyqxmd.com/read/28729836/an-overview-of-herbal-products-and-secondary-metabolites-used-for-management-of-type-two-diabetes
#2
REVIEW
Ajda Ota, Nataša P Ulrih
Diabetes mellitus is a common effect of uncontrolled high blood sugar and it is associated with long-term damage, dysfunction, and failure of various organs. In the adult population, the global prevalence of diabetes has nearly doubled since 1980. Without effective prevention and management programs, the continuing significant rise in diabetes will have grave consequences on the health and lifespan of the world population, and also on the world economy. Supplements can be used to correct nutritional deficiencies or to maintain an adequate intake of certain nutrients...
2017: Frontiers in Pharmacology
https://www.readbyqxmd.com/read/28729756/corrigendum-to-clinical-and-preclinical-cognitive-function-improvement-after-oral-treatment-of-a-botanical-composition-composed-of-extracts-from-scutellaria-baicalensis-and-acacia-catechu
#3
Mesfin Yimam, Bruce P Burnett, Lidia Brownell, Qi Jia
[This corrects the article DOI: 10.1155/2016/7240802.].
2017: Behavioural Neurology
https://www.readbyqxmd.com/read/28728492/the-bioactivity-of-hedysarum-coronarium-extracts-on-skin-enzymes-and-cells-correlates-with-phenolic-content
#4
Bruno Burlando, Giulia Pastorino, Annalisa Salis, Gianluca Damonte, Marco Clericuzio, Laura Cornara
CONTEXT: The search for bioactive compounds from botanical sources is attracting much interest. However, differences in chemical composition may occur within the same species depending on different geographical origins. OBJECTIVES: We evaluated the properties on skin enzymes and cells of extracts from sulla legume crop Hedysarum coronarium L. (Fabaceae), collected at two Italian sites near Pisa and Ventimiglia, for possible dermatological and cosmetic applications...
December 2017: Pharmaceutical Biology
https://www.readbyqxmd.com/read/28728124/thin-ferrihydrite-sediment-capping-sequestrates-phosphorus-experiencing-redox-conditions-in-a-shallow-temperate-lacustrine-wetland
#5
Yuanchun Zou, Michael R Grace, Keryn L Roberts, Xiaofei Yu
Synthesized ferrihydrite (Fh) with the dosages of 0.3, 0.6 and 0.9 cm thickness (labeled as Fh, 2Fh and 3Fh respectively, equivalent to 248-774 g/m(2)) were deployed to serve as the reactive capping layer covering the Ornamental Lake sediments, the Royal Botanic Garden of Melbourne. The sediments were exposed to an alternating regime of oxic/anoxic conditions using laboratory reactors for 45 days. Dynamics of dissolved oxygen (DO), pH, filterable reactive phosphorus (FRP), filterable ammonium (NH4(+)), nitrate and nitrite (NOx), total dissolved nitrogen (TDN) and dissolved iron (Fe) of overlying water were examined...
July 12, 2017: Chemosphere
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#6
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28718398/comparative-study-of-nmr-spectral-profiling-for-the-characterization-and-authentication-of-cannabis
#7
Xinyi Wang, Peter de Harrington, Steven Baugh
For the authentication of botanical materials, it is difficult to obtain representative reference materials because botanicals vary significantly with respect to cultivation conditions. Chemical profiling of plant extracts or spectral fingerprinting can differentiate botanicals and group them by their chemical profiles. NMR spectroscopy yields a powerful and useful method for profiling plant extracts. Both 500 MHz (1)H and (1)H-(1)H correlation NMR spectroscopy coupled with pattern recognition were used to discriminate among Cannabis samples...
July 18, 2017: Journal of AOAC International
https://www.readbyqxmd.com/read/28717591/nectar-living-yeasts-of-a-tropical-host-plant-community-diversity-and-effects-on-community-wide-floral-nectar-traits
#8
Azucena Canto, Carlos M Herrera, Rosalina Rodriguez
We characterize the diversity of nectar-living yeasts of a tropical host plant community at different hierarchical sampling levels, measure the associations between yeasts and nectariferous plants, and measure the effect of yeasts on nectar traits. Using a series of hierarchically nested sampling units, we extracted nectar from an assemblage of host plants that were representative of the diversity of life forms, flower shapes, and pollinator types in the tropical area of Yucatan, Mexico. Yeasts were isolated from single nectar samples; their DNA was identified, the yeast cell density was estimated, and the sugar composition and concentration of nectar were quantified using HPLC...
2017: PeerJ
https://www.readbyqxmd.com/read/28708468/a-botanical-composition-from-morus-alba-ilex-paraguariensis-and-rosmarinus-officinalis-for-body-weight-management
#9
Mesfin Yimam, Ping Jiao, Mei Hong, Lidia Brownell, Young-Chul Lee, Hyun-Jin Kim, Jeong-Bum Nam, Mi-Ran Kim, Qi Jia
Obesity is the largest and fastest growing public health catastrophe in the world affecting both adults and children with a prevalence impacting more than one-third of United States (US) adult population. Although the long-term solution lies in lifestyle changes in the form of dieting and exercise, intervention is required for those who are already obese. Unfortunately, treatment options remain quite limited due to associated side effects of conventional therapeutics. As a natural alternative, in this study we describe the beneficial effect of a standardized composition (UP603) comprised of extracts from Morus alba, Ilex paraguariensis, and Rosmarinus officinalis in improving metabolic disorders in high fat diet (HFD) and high fat & high fructose diet (HFFD) induced obese C57BL/6J mice...
July 14, 2017: Journal of Medicinal Food
https://www.readbyqxmd.com/read/28708125/structure-elucidation-and-botanical-characterization-of-diterpenes-from-a-specific-type-of-bee-glue
#10
Noushin Aminimoghadamfarouj, Alireza Nematollahi
Investigation of the single plant source bee glue type originating from Southern Australia resulted in the isolation and structure elucidation of major serrulatane diterpenes, novel 7,8,18-trihydroxyserrulat-14-ene (1), along with its oxidized product, 5,18-epoxyserrulat-14-en-7,8-dione (3) and known (18RS)-5,18-epoxyserrulat-14-en-8,18-diol (2). Exploration into the botanical origin revealed Myoporum insulare R. Br, as the plant source of the bee glue materials. This discovery was made through comparative analysis of the myoporum bee glue samples collected from the beehives, analyses of plant resinous exudate, and resin carried on the hind legs of bees foraging for bee glue...
July 14, 2017: Molecules: a Journal of Synthetic Chemistry and Natural Product Chemistry
https://www.readbyqxmd.com/read/28706348/a-methodological-approach-to-the-study-of-archaeological-cereal-meals-a-case-study-at-%C3%A3-atalh%C3%A3-y%C3%A3-k-east-turkey
#11
Lara González Carretero, Michèle Wollstonecroft, Dorian Q Fuller
This paper presents an integrated methodology for the analysis of archaeological remains of cereal meals, based on scanning electronic microscopic analyses of microstructures of charred food fragments from Neolithic Çatalhöyük (Turkey). The remains of cereal foods as 'bread-like' or 'porridge-like' small charred lumps of various amalgamated plant materials are frequently recovered from Neolithic and later archaeological sites in southwest Asia and Europe. Cereal food remains have recently attracted interest because the identification of their plant contents, the forms of food that they represent and the methods used in their creation can provide unique information about ancient culinary traditions and routine food processing, preparation and cooking techniques...
2017: Vegetation History and Archaeobotany
https://www.readbyqxmd.com/read/28702939/genetic-diversity-and-relatedness-among-ornamental-purslane-portulaca-l-accessions-unraveled-by-srap-markers
#12
Sizhen Jia, Zhiming Yan, Yuanhua Wang, Yue Wei, Zhenqiang Xie, Fei Zhang
Ornamental purslanes (Portulaca L.) are a popular annual bedding and container plant for landscaping. Little information is available concerning the genetic characterization of ornamental purslane resources thus far. The purpose of this study was to investigate the genetic diversity and relationships present in a collection of ornamental purslanes from Portulaca umbraticola and P. grandiflora cultivated in China, using sequence-related amplified polymorphism (SRAP) markers. The genotyping showed that 16 SRAP primer combinations totally produced 261 informative fragments and averaged 16...
August 2017: 3 Biotech
https://www.readbyqxmd.com/read/28701955/therapeutic-properties-of-bioactive-compounds-from-different-honeybee-products
#13
REVIEW
Laura Cornara, Marco Biagi, Jianbo Xiao, Bruno Burlando
Honeybees produce honey, royal jelly, propolis, bee venom, bee pollen, and beeswax, which potentially benefit to humans due to the bioactives in them. Clinical standardization of these products is hindered by chemical variability depending on honeybee and botanical sources, but different molecules have been isolated and pharmacologically characterized. Major honey bioactives include phenolics, methylglyoxal, royal jelly proteins (MRJPs), and oligosaccharides. In royal jelly there are antimicrobial jelleins and royalisin peptides, MRJPs, and hydroxy-decenoic acid derivatives, notably 10-hydroxy-2-decenoic acid (10-HDA), with antimicrobial, anti-inflammatory, immunomodulatory, neuromodulatory, metabolic syndrome preventing, and anti-aging activities...
2017: Frontiers in Pharmacology
https://www.readbyqxmd.com/read/28698155/in-silico-approach-to-safety-of-botanical-dietary-supplement-ingredients-utilizing-constituent-level-characterization
#14
Jason G Little, Daniel S Marsman, Timothy R Baker, Catherine Mahony
Botanicals used in dietary supplements industry can have toxicology concerns related to endpoint gaps that cannot be fully resolved by a history of use, or existence of conflicting safety data. However, traditional toxicological studies on botanicals are scientifically and pragmatically challenging due to testing of complex mixtures of constituents, cost, time, and animal usage. Alternatively, we developed an in silico decision-tree approach to address data gaps and inform need for further studies by toxicologically evaluating the chemical composition of botanicals...
July 8, 2017: Food and Chemical Toxicology
https://www.readbyqxmd.com/read/28696397/characterization-and-biological-evaluation-of-propolis-from-poland
#15
Milena Popova, Efstathia Giannopoulou, Krystyna Skalicka-Woźniak, Konstantia Graikou, Jaroslaw Widelski, Vassya Bankova, Haralabos Kalofonos, Gregory Sivolapenko, Katarzyna Gaweł-Bęben, Beata Antosiewicz, Ioanna Chinou
In this study, we assessed the therapeutic potential of propolis from Poland and performed chemical analysis by GC-MS, as well as determined its botanical origin. Chemical constituents typical for bud exudates of Populusnigra (section Aigeiros) were determined, however, glycerol esters of phenolic acids, as well as unusually high amounts of p-coumaric and ferulic acid and their benzyl esters, were also detected. These constituents are characteristic for buds of Populustremula (section Leuce). We also evaluated the antiproliferative effect of propolis extracts against nine human cancer cell lines...
July 11, 2017: Molecules: a Journal of Synthetic Chemistry and Natural Product Chemistry
https://www.readbyqxmd.com/read/28696163/evaluation-of-dietary-and-lifestyle-changes-as-modifiers-of-s100%C3%AE-levels-in-alzheimer-s-disease
#16
Nathan M D'Cunha, Andrew J McKune, Demosthenes B Panagiotakos, Ekavi N Georgousopoulou, Jackson Thomas, Duane D Mellor, Nenad Naumovski
There is a significant body of research undertaken in order to elucidate the mechanisms underlying the pathology of Alzheimer's disease (AD), as well as to discover early detection biomarkers and potential therapeutic strategies. One such proposed biomarker is the calcium binding protein S100β, which, depending on its local concentration, is known to exhibit both neurotrophic and neuroinflammatory properties in the central nervous system. At present, relatively little is known regarding the effect of chronic S100β disruption in AD...
July 11, 2017: Nutritional Neuroscience
https://www.readbyqxmd.com/read/28688843/chemical-stability-of-the-botanical-drug-substance-crofelemer-a-model-system-for-comparative-characterization-of-complex-mixture-drugs
#17
Asha Hewarathna, Olivier Mozziconacci, Maulik K Nariya, Peter A Kleindl, Jian Xiong, Adam C Fisher, Sangeeta B Joshi, C Russell Middaugh, M Laird Forrest, David B Volkin, Eric J Deeds, Christian Schöneich
As the second of a three part series of articles in this issue concerning the development of a mathematical model for comparative characterization of complex mixture drugs using Crofelemer (CF) as a model compound, this work focuses on the evaluation of the chemical stability profile of CF. CF is a biopolymer containing a mixture of proanthocyanidin oligomers which are primarily composed of gallocatechin with a small contribution from catechin. CF extracted from drug product was subjected to molecular weight-based fractionation and thiolysis...
July 5, 2017: Journal of Pharmaceutical Sciences
https://www.readbyqxmd.com/read/28688269/nature-based-solution-for-improving-mental-health-and-well-being-in-urban-areas
#18
Maja Vujcic, Jelena Tomicevic-Dubljevic, Mihailo Grbic, Dusica Lecic-Tosevski, Olivera Vukovic, Oliver Toskovic
The general disproportion of urban development and the socio-economical crisis in Serbia, followed by a number of acute and chronic stressors, as well as years of accumulated trauma, prevented the parallel physical, mental and social adaptation of society as a whole. These trends certainly affected the quality of mental health and well-being, particularly on the vulnerable urban population, increasing the absolute number of people with depression, stress and psychosomatic disorders. This study was pioneering in Serbia and was conducted in collaboration with the Faculty of Forestry, the Institute of Mental Health and the Botanical Garden in Belgrade, in order to understand how spending time and performing horticulture therapy in specially designed urban green environments can improve mental health...
July 4, 2017: Environmental Research
https://www.readbyqxmd.com/read/28686778/a-randomized-controlled-study-of-a-novel-botanical-acne-spot-treatment
#19
Deganit Barak-Shinar, Zoe Diana Draelos
<p>OBJECTIVE: The study evaluated the tolerability and efficacy of a new presented treatment for acne. The product is an OTC topical gel consisting of 2% SA, which is also enriched in botanicals that have been shown to have anti-inflammatory properties.</p> <p>DESIGN: The study was designed as a single-site, randomized, investigator-blinded, split-face 10-day study.</p> <p>SETTING: Subjects enrolled with a minimum of 2 inflammatory papular acne lesions and 2 non-inflammatory open or closed comedones on both sides of the face in symmetrical locations, to the greatest degree possible...
June 1, 2017: Journal of Drugs in Dermatology: JDD
https://www.readbyqxmd.com/read/28686323/exploration-of-phytoconstituents-from-mussaenda-roxburghii-and-studies-of-their-antibiofilm-effect
#20
Ranjit Ghosh, Manash C Das, Arpita Sarkar, Antu Das, Padmani Sandhu, Biswanath Dinda, Yusuf Akhter, Surajit Bhattacharjee, Utpal Ch De
In the context of ethno botanical importance with no phytochemical investigations, Mussaenda roxburghii have been investigated to explore it's phytoconstituents and studies of their antibiofilm activity. Four compounds have been isolated from the aerial parts of this plant and were characterized as 2α, 3β, 19α, 23-tetrahydroxyurs-12-en-28-oic acid (1), β-sitosterol glucoside (4), lupeol palmitate (5) and myoinositol (6). All these compounds were tested for antibacterial and antibiofilm activity against Pseudomonas aeruginosa...
July 7, 2017: Chemistry & Biodiversity
keyword
keyword
39894
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"