keyword
MENU ▼
Read by QxMD icon Read
search

Dna extraction

keyword
https://www.readbyqxmd.com/read/28728275/-changes-and-differences-of-dna-methylation-in-human-macrophages-infected-with-virulent-and-avirulent-mycobacterium-tuberculosis
#1
L N Lyu, H Y Jia, Z H Li, Z Q Liu, Z D Zhang
Objective: To profile DNA methylation and compare differentially methylated region (DMR) of macrophages infected with virulent and avirulent strains of Mycobacterium tuberculosis (MTB). Methods: PMA(50 ng/ml) treated THP-1 macrophages were left uninfected or infected with the virulent H37Rv(THP-1/Rv) or avirulent H37Ra(THP-1/Ra). The genomic DNA was then extracted and DNA methylation was profiled via Reduced Representation Bisulfite Sequencing (RRBS). The DNA methylation pattern and DMRs between the tested samples were indentified...
July 12, 2017: Chinese Journal of Tuberculosis and Respiratory Diseases
https://www.readbyqxmd.com/read/28728263/-identification-of-mutations-associated-with-coronary-artery-lesion-susceptibility-in-kawasaki-disease-by-targeted-enrichment-of-genomic-region-sequencing-technique
#2
D Y Zhu, S R Song, L J Xie, F Qiu, J Yang, T T Xiao, M Huang
Objective: To screen and identify the mutations in Kawasaki disease by targeted enrichment of genomic region sequencing technique and investigate susceptibility genes associated with coronary artery lesion. Method: This was a case-control study.A total of 114 patients diagnosed as Kawasaki disease treated in Shanghai Children's Hospital between December 2015 and November 2016 were studied and another 45 healthy children who were physically examined in outpatient department were enrolled as control group. Patients were divided into two groups based on the results of echocardiogram...
July 2, 2017: Zhonghua Er Ke za Zhi. Chinese Journal of Pediatrics
https://www.readbyqxmd.com/read/28728156/predicting-the-risk-to-develop-preeclampsia-in-the-first-trimester-combining-promoter-variant-98a-c-of-lgals13-placental-protein-13-black-ethnicity-previous-preeclampsia-obesity-and-maternal-age
#3
Liora Madar-Shapiro, Ido Karady, Alla Trahtenherts, Argryo Syngelaki, Ranjit Akolekar, Liona Poon, Ruth Cohen, Adi Sharabi-Nov, Berthold Huppertz, Marei Sammar, Kata Juhasz, Nandor Gabor Than, Zoltan Papp, Roberto Romero, Kypros H Nicolaides, Hamutal Meiri
BACKGROUND: LGALS13 (placental protein 13 [PP13]) promoter DNA polymorphisms was evaluated in predicting preeclampsia (PE), given PP13's effects on hypotension, angiogenesis, and immune tolerance. METHODS: First-trimester plasma samples (49 term and 18 intermediate) of PE cases matched with 196 controls were collected from King's College Hospital, London, repository. Cell-free DNA was extracted and the LGALS13 exons were sequenced after PCR amplification. Expression of LGALS13 promoter reporter constructs was determined in BeWo trophoblast-like cells with luciferase assays...
July 21, 2017: Fetal Diagnosis and Therapy
https://www.readbyqxmd.com/read/28728054/an-artificial-neural-network-system-to-identify-alleles-in-reference-electropherograms
#4
Duncan Taylor, Ash Harrison, David Powers
Electropherograms are produced in great numbers in forensic DNA laboratories as part of everyday criminal casework. Before the results of these electropherograms can be used they must be scrutinised by analysts to determine what the identified data tells them about the underlying DNA sequences and what is purely an artefact of the DNA profiling process. This process of interpreting the electropherograms can be time consuming and is prone to subjective differences between analysts. Recently it was demonstrated that artificial neural networks could be used to classify information within an electropherogram as allelic (i...
July 8, 2017: Forensic Science International. Genetics
https://www.readbyqxmd.com/read/28727769/small-subunit-ribosomal-metabarcoding-reveals-extraordinary-trypanosomatid-diversity-in-brazilian-bats
#5
Maria Augusta Dario, Ricardo Moratelli Mendonça da Rocha, Philipp Schwabl, Ana Maria Jansen, Martin S Llewellyn
BACKGROUND: Bats are a highly successful, globally dispersed order of mammals that occupy a wide array of ecological niches. They are also intensely parasitized and implicated in multiple viral, bacterial and parasitic zoonosis. Trypanosomes are thought to be especially abundant and diverse in bats. In this study, we used 18S ribosomal RNA metabarcoding to probe bat trypanosome diversity in unprecedented detail. METHODOLOGY/PRINCIPAL FINDINGS: Total DNA was extracted from the blood of 90 bat individuals (17 species) captured along Atlantic Forest fragments of Espírito Santo state, southeast Brazil...
July 20, 2017: PLoS Neglected Tropical Diseases
https://www.readbyqxmd.com/read/28727723/analytical-sensitivity-and-specificity-of-a-loop-mediated-isothermal-amplification-lamp-kit-prototype-for-detection-of-trypanosoma-cruzi-dna-in-human-blood-samples
#6
Susana A Besuschio, Mónica Llano Murcia, Alejandro F Benatar, Severine Monnerat, Israel Cruz Mata, Albert Picado de Puig, María de Los Ángeles Curto, Yutaka Kubota, Diana P Wehrendt, Paula Pavia, Yasuyoshi Mori, Concepción Puerta, Joseph M Ndung'u, Alejandro G Schijman
This study aimed to assess analytical parameters of a prototype LAMP kit that was designed for detection of Trypanosoma cruzi DNA in human blood. The prototype is based on the amplification of the highly repetitive satellite sequence of T.cruzi in microtubes containing dried reagents on the inside of the caps. The reaction is carried out at 65°C during 40 minutes. Calcein allows direct detection of amplified products with the naked eye. Inclusivity and selectivity were tested in purified DNA from Trypanosoma cruzi stocks belonging to the six discrete typing units (DTUs), in DNA from other protozoan parasites and in human DNA...
July 20, 2017: PLoS Neglected Tropical Diseases
https://www.readbyqxmd.com/read/28726934/clove-extract-functions-as-a-natural-fatty-acid-synthesis-inhibitor-and-prevents-obesity-in-a-mouse-model
#7
Yiran Ding, Zhennan Gu, Yihe Wang, Shunhe Wang, Haiqin Chen, Hao Zhang, Wei Chen, Yong Q Chen
Numerous medicinal plants have been reported to prevent various chronic diseases. In this study, we screened a new FASN inhibitor-alcohol extract of clove (AEC) using a fast microplate method developed in our laboratory. The major components of AEC were: eugenol (42.27%), acetyl eugenol (29.12%), caryophyllene (15.40%), and humulene (3.22%). Fatty acid synthase (FASN) is a key enzyme for de novo lipogenesis, and it has been suggested as a potential therapeutic target in cancer and obesity. We have tested the ability of AEC to inhibit FASN in mammalian cells and tissues...
July 20, 2017: Food & Function
https://www.readbyqxmd.com/read/28725280/single-molecule-quantification-of-5-hydroxymethylcytosine-for-diagnosis-of-blood-and-colon-cancers
#8
Noa Gilat, Tzlil Tabachnik, Amit Shwartz, Tamar Shahal, Dmitry Torchinsky, Yael Michaeli, Gil Nifker, Shahar Zirkin, Yuval Ebenstein
BACKGROUND: The DNA modification 5-hydroxymethylcytosine (5hmC) is now referred to as the sixth base of DNA with evidence of tissue-specific patterns and correlation with gene regulation and expression. This epigenetic mark was recently reported as a potential biomarker for multiple types of cancer, but its application in the clinic is limited by the utility of recent 5hmC quantification assays. We use a recently developed, ultra-sensitive, fluorescence-based single-molecule method for global quantification of 5hmC in genomic DNA...
2017: Clinical Epigenetics
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#9
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28724259/herbal-pre-conditioning-induces-proliferation-and-delays-senescence-in-wharton-s-jelly-mesenchymal-stem-cells
#10
Avinash Sanap, Bhawna Chandravanshi, Tejas Shah, Girish Tillu, Anand Dhanushkodi, Ramesh Bhonde, Kalpana Joshi
BACKGROUND: Mesenchymal Stem Cells (MSCs) are multipotent stem cells which are being explored for various clinical applications. Isolation and in-vitro expansion of MSCs remain important in achieving desired cell number for the therapy. However, in-vitro proliferation of MSCs is often associated with senescence and early onset of apoptosis which limits its therapeutic ability and long term clinical use. Tinospora cordifolia and Withania somnifera are used widely in Ayurveda: the traditional Indian system of medicine and are reported to have rejuvenating and anti-aging potential...
July 15, 2017: Biomedicine & Pharmacotherapy, Biomédecine & Pharmacothérapie
https://www.readbyqxmd.com/read/28724197/discrimination-and-characterization-of-two-mediterranean-species-from-the-laurencia-complex-rhodomelacea-using-an-nmr-based-metabolomic-approach
#11
Sylvain Sutour, Hélène Esselin, Ange Bighelli, Joseph Casanova, Line Le Gall, Félix Tomi
Generic and specific determination among the Laurencia complex is a challenging task. DNA barcoding combined with phenotypic investigations are mandatory for species differentiation. In this study, two morphologically different members of the Laurencia complex were investigated using untargeted (1) H NMR-based metabolomics. Twenty-one population samples were collected in order to evaluate both temporal and geographical homogeneity. Data obtained from (1) H NMR analysis followed by statistical analysis allowed a clear separation of all the samples into two groups...
July 19, 2017: Chemistry & Biodiversity
https://www.readbyqxmd.com/read/28723497/pharmacogenomic-markers-of-targeted-therapy-toxicity-in-patients-with-metastatic-renal-cell-carcinoma
#12
Guillermo de Velasco, Kathryn P Gray, Lana Hamieh, Yuksel Urun, Hallie A Carol, Andre P Fay, Sabina Signoretti, David J Kwiatkowski, David F McDermott, Matthew Freedman, Mark M Pomerantz, Toni K Choueiri
BACKGROUND: Targeted therapy (TT) in metastatic renal cell carcinoma (mRCC) may be associated with a high rate of toxicity that undermines treatment efficacy and patient quality of life. Polymorphisms in genes involved in the pharmacokinetic pathways of TTs may predict toxicity. OBJECTIVE: To investigate whether selected single-nucleotide polymorphisms (SNPs) in three core genes involved in the metabolism and transport of sunitinib and the mTOR inhibitors everolimus and temsirolimus are associated with adverse events (AEs)...
December 15, 2016: European Urology Focus
https://www.readbyqxmd.com/read/28723166/automated-3-d-printed-arrays-to-evaluate-genotoxic-chemistry-e-cigarettes-and-water-samples
#13
Karteek Kadimisetty, Spundana Malla, James F Rusling
A novel, automated, low cost, three-dimensional (3-D) printed microfluidic array was developed to detect DNA damage from metabolites of chemicals in environmental samples. The electrochemiluminescent (ECL) detection platform incorporates layer-by-layer (LbL) assembled films of microsomal enzymes, DNA and an ECL-emitting ruthenium metallopolymer in ∼10 nm deep microwells. Liquid samples are introduced into the array, metabolized by the human enzymes, products react with DNA if possible, and DNA damage is detected by ECL with a camera...
May 26, 2017: ACS Sensors
https://www.readbyqxmd.com/read/28722567/bartonella-infection-in-hematophagous-insectivorous-and-phytophagous-bat-populations-of-central-mexico-and-the-yucatan-peninsula
#14
Matthew J Stuckey, Bruno B Chomel, Guillermo Galvez-Romero, José Ignacio Olave-Leyva, Cirani Obregón-Morales, Hayde Moreno-Sandoval, Nidia Aréchiga-Ceballos, Mónica Salas-Rojas, Alvaro Aguilar-Setién
Although emerging nonviral pathogens remain relatively understudied in bat populations, there is an increasing focus on identifying bat-associated bartonellae around the world. Many novel Bartonella strains have been described from both bats and their arthropod ectoparasites, including Bartonella mayotimonensis, a zoonotic agent of human endocarditis. This cross-sectional study was designed to describe novel Bartonella strains isolated from bats sampled in Mexico and evaluate factors potentially associated with infection...
June 12, 2017: American Journal of Tropical Medicine and Hygiene
https://www.readbyqxmd.com/read/28722430/multi-amplified-sensing-of-microrna-by-a-small-dna-fragment-driven-enzymatic-cascade-reaction
#15
Eunjung Kim, Philip D Howes, Spencer W Crowder, Molly M Stevens
Combining technological developments such as nanomaterials, DNA nanotechnology, and functional enzymes has great potential to facilitate next generation high performance molecular diagnostic systems. In this work, we describe a microRNA (miRNA) detection assay that combines target recycling and isothermal amplification in an elegantly designed enzyme-mediated cascade reaction. Target recycling is driven by the action of duplex-specific nuclease (DSN), resulting in highly amplified translation of input miRNA to short output DNA fragments...
January 27, 2017: ACS Sensors
https://www.readbyqxmd.com/read/28722238/the-preparation-of-microfluidic-architecture-with-monolithic-materials-using-a-dual-porous-silica-structure
#16
Christopher Birch, Mohammad Mehdi Nasr Esfahani, Kirsty J Shaw, Cordula Kemp, Stephen James Haswell, Charlotte Dyer
A microfluidic device (MD) has been developed which features a porous silica (PS) monolithic disk synthesized from tetramethyl orthosilicate (TMOS), incorporated into the device post-fabrication and sealed in place with a second PS monolithic layer, synthesized from potassium silicate. This dual porous silica (DPS) structure provides a pathway for sample introduction to the microfluidic device and offers an ideal platform for solid phase extraction (SPE) methodologies which can be rapidly and efficiently integrated into a chip-based format...
July 19, 2017: Electrophoresis
https://www.readbyqxmd.com/read/28721842/rapid-seafood-species-identification-using-chip-based-capillary-electrophoresis-and-protein-pattern-matching
#17
Calvin Walker, Cheryl Lassitter, Shannara Lynn, Courtney Ford, Kevin Rademacher, Angela Ruple, Jon Bell
Authenticity is crucial to the seafood industry, as substitution and mislabeling have important economic, environmental, and food safety consequences. To address this problem, protein profiling and software algorithm techniques were developed to classify fish muscle samples by species. The method uses water-based protein extraction, chip-based microfluidic electrophoresis (Agilent 2100 Bioanalyzer) for the analysis of high abundance fish muscle proteins, and a novel data analysis method for species-specific protein pattern recognition...
July 19, 2017: Journal of AOAC International
https://www.readbyqxmd.com/read/28721668/quantitative-analysis-of-s-mutans-lactobacillus-and-bifidobacterium-found-in-initial-and-mature-plaques-in-thai-children-with-early-childhood-caries
#18
K Mitrakul, S Chanvitan, A Jeamset, K Vongsawan
AIMS: To quantify Streptococcus mutans, lactobacillus and bifidobacterium in initial and mature plaque collected from children with severe early childhood caries (S-ECC) and caries-free (CF) groups and to analyse the association between these bacteria and caries-related factors in each group. STUDY DESIGN: A collection of 120 initial and overnight supra-gingival plaques were collected from Thai children aged 2-5 years-old (S-ECC = 60, CF = 60). Plaque, gingival indices and decayed, missing, filled tooth (dmft) scores were recorded...
July 18, 2017: European Archives of Paediatric Dentistry: Official Journal of the European Academy of Paediatric Dentistry
https://www.readbyqxmd.com/read/28721204/initial-genome-sequencing-of-the-sugarcane-cp-96-1252-complex-hybrid
#19
Jason R Miller, Kari A Dilley, Derek M Harkins, Manolito G Torralba, Kelvin J Moncera, Karen Beeri, Karrie Goglin, Timothy B Stockwell, Granger G Sutton, Reed S Shabman
The CP 96-1252 cultivar of sugarcane is a complex hybrid of commercial importance. DNA was extracted from lab-grown leaf tissue and sequenced. The raw Illumina DNA sequencing results provide 101 Gbp of genome sequence reads. The dataset is available from https://www.ncbi.nlm.nih.gov/bioproject/PRJNA345486/.
2017: F1000Research
https://www.readbyqxmd.com/read/28720805/a-portable-system-for-rapid-bacterial-composition-analysis-using-a-nanopore-based-sequencer-and-laptop-computer
#20
Satomi Mitsuhashi, Kirill Kryukov, So Nakagawa, Junko S Takeuchi, Yoshiki Shiraishi, Koichiro Asano, Tadashi Imanishi
We developed a portable system for 16S rDNA analyses consisting of a nanopore technology-based sequencer, the MinION, and laptop computers, and assessed its potential ability to determine bacterial compositions rapidly. We tested our protocols using a mock bacterial community that contained equimolar 16S rDNA and a pleural effusion from a patient with empyema, for time effectiveness and accuracy. MinION sequencing targeting 16S rDNA detected all 20 of the bacterial species present in the mock bacterial community...
July 18, 2017: Scientific Reports
keyword
keyword
36447
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"