keyword
MENU ▼
Read by QxMD icon Read
search

Ccc DNA

keyword
https://www.readbyqxmd.com/read/29893701/frequency-and-characteristics-of-occult-hepatitis-b-infection-among-hepatocellular-carcinoma-patients-in-japan
#1
Jun Muto, Masaya Sugiyama, Ken Shirabe, Motokazu Mukaide, Ikue Kirikae-Muto, Toru Ikegami, Tomoharu Yoshizumi, Yo-Ichi Yamashita, Yoshihiko Maehara, Masashi Mizokami
INTRODUCTION AND AIM: Occult hepatitis B virus (HBV) infection (OBI) represents a state without detectable hepatitis B surface antigen, but positive for HBV DNA. The correlation between OBI and hepatocellular carcinoma (HCC) carcinogenesis is controversial. We studied the frequency and characteristics of OBI among HCC patients and metastatic liver cancer patients. MATERIAL AND METHODS: DNA was obtained from tumor and non-tumor tissues from 75 HCC patients (15 chronic hepatitis B (CHB), 39 chronic hepatitis C (CHC), 21 cryptogenic) and 15 metastatic liver cancer patients who underwent liver resection...
July 2018: Annals of Hepatology
https://www.readbyqxmd.com/read/29893548/virological-basis-for-the-cure-of-chronic-hepatitis-b
#2
Jin Hu, Junjun Cheng, Liudi Tang, Zhanying Hu, Yue Luo, Yu-Huan Li, Tianlun Zhou, Jinhong Chang, Ju-Tao Guo
Hepatitis B virus (HBV) has infected one-third of world population and 240 million people are chronic carriers, to whom a curative therapy is still not available. Similar to other viruses, persistent HBV infection relies on the virus to exploit host cell functions to support its replication and efficiently evade host innate and adaptive antiviral immunity. Understanding HBV replication and concomitant host cell interactions is thus instrumental for development of therapeutics to disrupt the virus-host interactions critical for its persistence and cure chronic hepatitis B...
June 12, 2018: ACS Infectious Diseases
https://www.readbyqxmd.com/read/29785877/hepatitis-b-virus-lymphotropism-emerging-details-and-challenges
#3
Shivali S Joshi, Carla S Coffin
The hepatitis B virus (HBV) is predominantly a hepatotropic virus but also infects cells of the lymphatic system. HBV genomes (DNA, messenger (m)RNA, covalently closed circular (ccc) DNA) and proteins have been found in extrahepatic sites such as peripheral blood mononuclear cells (PBMC), lymph nodes, spleen, bone marrow and cerebrospinal fluid. HBV entry into hepatocytes occurs by binding of the HBV preS1 surface protein to its specific receptor, the bile acid transporter, sodium taurocholate co-transporting polypeptide (NTCP)...
April 2018: Biotechnology & Genetic Engineering Reviews
https://www.readbyqxmd.com/read/29707125/the-hnf-1%C3%AE-usp28-claspin-pathway-upregulates-dna-damage-induced-chk1-activation-in-ovarian-clear-cell-carcinoma
#4
Fuminori Ito, Chiharu Yoshimoto, Yuki Yamada, Tamotsu Sudo, Hiroshi Kobayashi
Transcription factor hepatocyte nuclear factor 1-beta (HNF-1β) enhances checkpoint kinase 1 (Chk1) activation and promotes G2/M cell cycle progression in ovarian clear cell carcinoma (CCC) following exposure to diverse genotoxic agents including bleomycin. However, the underlying mechanism leading to checkpoint activation of HNF-1β still remains largely unknown. To clarify the effects of HNF-1β on cell cycle checkpoints, human CCC cell lines were transfected with siRNAs targeting HNF-1β, Claspin , USP28, or a control vector...
April 3, 2018: Oncotarget
https://www.readbyqxmd.com/read/29500037/hepatitis-b-virus
#5
Chiaho Shih, Ching-Chun Yang, Gansukh Choijilsuren, Chih-Hsu Chang, An-Ting Liou
This infographic about hepatitis B virus explores its replication cycle, natural history of infection and pathogenesis, and how this can be controlled and treated. Hepatitis B virus (HBV) is a common worldwide blood-borne pathogen. Chronic hepatitis B can progress to an inactive carrier state, and then, in some patients, give rise to cirrhosis and cancer of the liver, leading to death. An HBV surface-antigen vaccine is effective, but treatments are currently not curative. HBV replicates via reverse transcription...
April 2018: Trends in Microbiology
https://www.readbyqxmd.com/read/29474637/uncommon-human-telomerase-reverse-transcriptase-promoter-mutations-are-associated-with-poor-survival-in-ovarian-clear-cell-carcinoma
#6
Kyoko Nishikimi, Kiyoshi Nakagawa, Shinichi Tate, Ayumu Matsuoka, Masami Iwamoto, Takako Kiyokawa, Makio Shozu
Objectives: The present study assessed whether human telomerase reverse transcriptase (TERT) promoter mutations mediate the increased mortality risk observed in patients with ovarian clear cell carcinoma (CCC) and characterized the pathologic features of TERT promoter mutation-associated ovarian CCC. Methods: The TERT promoter region in genomic DNA extracted from paraffin-embedded ovarian CCC specimens (n = 93) was bidirectionally sequenced. Results: A total of 24 TERT promoter mutations were identified among the analyzed CCC cases, of which 11 were known "hotspot" mutations whose frequency was increased in CCC cases with compared to without coexistent adenofibroma (P < ...
March 7, 2018: American Journal of Clinical Pathology
https://www.readbyqxmd.com/read/29356530/probing-the-ionic-atmosphere-and-hydration-of-the-c-myc-i-motif
#7
Lutan Liu, Byul G Kim, Ujala Feroze, Robert B Macgregor, Tigran V Chalikian
G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN)...
February 14, 2018: Journal of the American Chemical Society
https://www.readbyqxmd.com/read/29336691/the-evaluation-of-cr-curcumin-dna-complexation-by-experimental-and-theoretical-approaches
#8
Farhad Ahmadi, Teymour Vahedpour, Ali Akbar Alizadeh
Chromium(III) chloride mediates DNA-DNA cross-linking. Some chromium complexes promote programmed cell death in specific ligand environment through binding to DNA. One strategy that can be supposed for reduction of Cr3+ binding affinity to DNA is using curcumin as a chelator. In the current study, the [Cr(Curcumin)(EtOH)2 ](NO3 )2 (CCC) was synthesized and characterized by UV/Vis, FT-IR, CHN and spectrophotometric titration techniques. The mole ratio plot revealed a 1:1 complex between Cr3+ and curcumin in solution...
January 2, 2018: Nucleosides, Nucleotides & Nucleic Acids
https://www.readbyqxmd.com/read/29322505/impact-of-bistrand-abasic-sites-and-proximate-orientation-on-dna-global-structure-and-duplex-energetics
#9
Conceição A Minetti, Jeffrey Y Sun, Daniel P Jacobs, Inkoo Kang, David P Remeta, Kenneth J Breslauer
Bistrand lesions embedded within a single helical turn of tridecameric deoxyoligonucleotide duplexes represent a model system for exploring the impact of clustered lesions that occur in vivo and pose a significant challenge to cellular repair machineries. Such investigations are essential for understanding the forces that dictate lesion-induced mutagenesis, carcinogenesis, and cytotoxicity within a context that mimics local helical perturbations caused by an ionizing radiation event. This study characterizes the structural and energy profiles of DNA duplexes harboring synthetic abasic sites (tetrahydrofuran, F) as models of clustered bistrand abasic (AP) lesions...
January 11, 2018: Biopolymers
https://www.readbyqxmd.com/read/29287110/the-role-of-host-dna-ligases-in-hepadnavirus-covalently-closed-circular-dna-formation
#10
Quanxin Long, Ran Yan, Jieli Hu, Dawei Cai, Bidisha Mitra, Elena S Kim, Alexander Marchetti, Hu Zhang, Soujuan Wang, Yuanjie Liu, Ailong Huang, Haitao Guo
Hepadnavirus covalently closed circular (ccc) DNA is the bona fide viral transcription template, which plays a pivotal role in viral infection and persistence. Upon infection, the non-replicative cccDNA is converted from the incoming and de novo synthesized viral genomic relaxed circular (rc) DNA, presumably through employment of the host cell's DNA repair mechanisms in the nucleus. The conversion of rcDNA into cccDNA requires preparation of the extremities at the nick/gap regions of rcDNA for strand ligation...
December 2017: PLoS Pathogens
https://www.readbyqxmd.com/read/29229516/dissimilar-substitution-rates-between-two-strands-of-dna-influence-codon-usage-pattern-in-some-human-genes
#11
Binata Halder, Arup Kumar Malakar, Supriyo Chakraborty
We illustrated the descriptive aspects of codon usage of some important human genes and their expression potential in E. coli. By comparing the results of various codon usage parameters, effects that are due to selection and mutational pressures have been deciphered. The variation in GC3s explains a significant proportion of the variation in codon usage patterns. The codons CGC, CGG, CTG and GCG showed strong positive correlation with GC3, which suggested that codon usage had been influenced by GC bias. We also found that ACC (Thr, RSCU-1...
March 1, 2018: Gene
https://www.readbyqxmd.com/read/29224148/digital-restriction-enzyme-analysis-of-methylation-dream
#12
Jaroslav Jelinek, Justin T Lee, Matteo Cesaroni, Jozef Madzo, Shoudan Liang, Yue Lu, Jean-Pierre J Issa
Digital Restriction Enzyme Analysis of Methylation (DREAM) is a method for quantitative mapping of DNA methylation across genomes using next-generation sequencing (NGS) technology. The method is based on sequential cuts of genomic DNA with a pair of restriction enzymes (SmaI and XmaI) at CCCGGG target sites. Unmethylated sites are first digested with SmaI. This enzyme cuts the sites in the middle at CCC^GGG, leaving behind blunt ended fragments. CpG methylation completely blocks SmaI; therefore, only unmethylated sites are cleaved...
2018: Methods in Molecular Biology
https://www.readbyqxmd.com/read/29169914/low-incidence-of-precore-w28-mutant-variants-in-treated-hepatitis-b-virus-and-human-immunodeficiency-virus-co-infected-patients
#13
Anders Boyd, Karine Lacombe, Fabien Lavocat, Patrick Miailhes, Caroline Lascoux-Combe, Pierre-Maire Girard, Fabien Zoulim
The precore (pc) W28* mutation arises from immune-selective pressures during the hepatitis B "e" antigen (HBeAg)-positive phase of chronic hepatitis B virus (HBV) infection and has been linked to severe liver-related morbidity. Here, we examined the determinants of harboring this mutation and its rate of emergence in treated patients co-infected with human immunodeficiency virus (HIV) and HBV. In a three-year prospective cohort of 165 HIV-HBV co-infected patients, pcW28* mutation was determined via DNA-chip during yearly sampling...
January 2018: Antiviral Research
https://www.readbyqxmd.com/read/29109859/candidate-synthetic-lethality-partners-to-parp-inhibitors-in-the-treatment-of-ovarian-clear-cell-cancer
#14
Naoki Kawahara, Kenji Ogawa, Mika Nagayasu, Mai Kimura, Yoshikazu Sasaki, Hiroshi Kobayashi
Inhibitors of poly(ADP-ribose) polymerase (PARP) are new types of personalized treatment of relapsed platinum-sensitive ovarian cancer harboring BRCA1/2 mutations. Ovarian clear cell cancer (CCC), a subset of ovarian cancer, often appears as low-stage disease with a higher incidence among Japanese. Advanced CCC is highly aggressive with poor patient outcome. The aim of the present study was to determine the potential synthetic lethality gene pairs for PARP inhibitions in patients with CCC through virtual and biological screenings as well as clinical studies...
November 2017: Biomedical Reports
https://www.readbyqxmd.com/read/29066915/molecular-alterations-and-clinical-prognostic-factors-for-cholangiocarcinoma-in-thai-population
#15
N Trachu, E Sirachainan, N Larbcharoensub, W Rattanadech, S Detarkom, N Monnamo, K Kamprerasart, D MunTham, C Sukasem, T Reungwetwattana
This study explores genomic alterations in cholangiocarcinoma (CCC) tissues in Thai patients. We identified and reviewed the records of patients who had been diagnosed with CCC and for whom sufficient tumor samples for DNA and RNA extraction were available in our database. The specimens were explored for EGFR , KRAS , BRAF , and PIK3CA mutations and ROS1 translocation in 81 samples. Immunohistochemistry staining for HER2, ALK, and Ki-67 expression was tested in 74 samples. Prevalence of EGFR , KRAS , and PIK3CA mutations in this study was 21%, 12%, and 16%, respectively...
2017: OncoTargets and Therapy
https://www.readbyqxmd.com/read/29066493/capillarys-2-flex-piercing-detected-a-rare-case-of-hb-broomhill
#16
Liqin Ling, Hao Chen, Chaonan Liu, Si Chen, YaXiong Jin, Jing Zhou
We report a case of an extremely rare hemoglobin (Hb) variant-Hb Broomhill, which has been only reported once in the literature. Hemoglobin fractions were determined by capillary electrophoresis (Sebia Capillarys 2 Flex piercing) and high performance liquid chromatography (HPLC) (Bio-Rad Variant™ II Hemoglobin Testing System), respectively. Complete blood count and DNA sequencing were also performed. The capillary electrophoregram revealed a tiny shoulder peak before the HbA peak and a subtle abnormal HbA2 peak (slightly wider and lower), even though the percentage of each hemoglobin fraction was within the reference range (HbA, 97...
September 2017: Annals of Clinical and Laboratory Science
https://www.readbyqxmd.com/read/29062901/new-directions-in-hepatitis-b-therapy-research
#17
REVIEW
Marta Lewandowska, Anna Piekarska
Chronic hepatitis B treatment is available for a long period, allowing disease control and infection suppression, but it is rarely responsible for HBsAg clearance. None of the drugs available aim at cccDNA, the obstacle in HBV infection eradication. Complications related to CHB, such as liver insufficiency, cirrhosis, and hepatocellular carcinoma are reduced in conditions of good viremia suppression, but still exist even after HBsAg seroclearance, what makes a need for urgent forthcoming of new therapeutics...
September 2017: Clinical and experimental hepatology
https://www.readbyqxmd.com/read/29046450/distribution-of-hepatitis-b-virus-nuclear-dna
#18
Mingming Li, Ji A Sohn, Christoph Seeger
Chronic hepatitis B affects over 300 million people who are at risk of developing liver cancer. The basis for the persistence of hepatitis B virus (HBV) in hepatocytes, even in the presence of available antiviral therapies, lies in the accumulation of covalently closed circular DNA (cccDNA) in nuclei of infected cells. While methods for cccDNA quantification from liver biopsy specimens and cell lines expressing the virus are known, information about cccDNA formation, stability, and turnover is lacking. In particular, little is known about the fate of cccDNA during cell division...
January 1, 2018: Journal of Virology
https://www.readbyqxmd.com/read/28991213/predictive-qsar-models-for-the-toxicity-of-disinfection-byproducts
#19
Litang Qin, Xin Zhang, Yuhan Chen, Lingyun Mo, Honghu Zeng, Yanpeng Liang
Several hundred disinfection byproducts (DBPs) in drinking water have been identified, and are known to have potentially adverse health effects. There are toxicological data gaps for most DBPs, and the predictive method may provide an effective way to address this. The development of an in-silico model of toxicology endpoints of DBPs is rarely studied. The main aim of the present study is to develop predictive quantitative structure-activity relationship (QSAR) models for the reactive toxicities of 50 DBPs in the five bioassays of X-Microtox, GSH+, GSH-, DNA+ and DNA-...
October 9, 2017: Molecules: a Journal of Synthetic Chemistry and Natural Product Chemistry
https://www.readbyqxmd.com/read/28966231/aminoglycoside-resistance-of-trueperella-pyogenes-isolated-from-pigs-in-china
#20
Wen-Long Dong, Ling-Cong Kong, Yu Wang, Chang-Long Gou, Bo Xu, Hong-Xia Ma, Yun-Hang Gao
We aimed to determine the resistance mechanisms of 27 T. pyogenes isolates from swine in the Jilin province of China. Drug sensitivity analysis indicated that most of the isolated strains were resistant to aminoglycosides. We investigated the genes involved in target alteration, drug inactivation, and increased efflux as potential resistance mechanisms. Two known aminoglycoside resistance genes (aphA1 and strB) were not found in the genomic DNA of any isolate. A 3-bp (CCC) deletion in one 16S rRNA operon was detected in all isolates, and efflux pumps were not active in the resistant group...
November 17, 2017: Journal of Veterinary Medical Science
keyword
keyword
36207
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"