keyword
MENU ▼
Read by QxMD icon Read
search

Osteogenesis imperfecta

keyword
https://www.readbyqxmd.com/read/29165672/trans-sylvian-approach-to-microvascular-decompression-for-trigeminal-neuralgia-in-syndromic-cranial-base-settling
#1
Mrityunjoy Sarkar, Ashok Pillai
BACKGROUND AND IMPORTANCE: The lateral suboccipital approach for microvascular decompression (MVD) of the trigeminal nerve has become a standard-of-care over the past several decades. Syndromic cranial base settling, a rare but known cause for trigeminal neuralgia (TN), poses significant dilemmas in clinical management. In such cases, distorted anatomy may render surgery via the suboccipital approach difficult or even impossible. CLINICAL PRESENTATION: A 34-yr-old male with osteogenesis imperfecta and severe basilar invagination suffered from TN that was refractory to medication and stereotactic radiosurgery...
November 18, 2017: Operative Neurosurgery (Hagerstown, Md.)
https://www.readbyqxmd.com/read/29158687/novel-mutation-of-fkbp10-in-a-pediatric-patient-with-osteogenesis-imperfecta-type-xi-identified-by-clinical-exome-sequencing
#2
Harvy Mauricio Velasco, Jessica L Morales
Osteogenesis imperfecta (OI) is a hereditary disease characterized by bone fragility caused by mutations in the proteins that support the formation of the extracellular matrix in the bone. The diagnosis of OI begins with clinical suspicion, from phenotypic findings at birth, low-impact fractures during childhood or family history that may lead to it. However, the variability in the semiology of the disease does not allow establishing an early diagnosis in all cases, and unfortunately, specific clinical data provided by the literature only report 28 patients with OI type XI...
2017: Application of Clinical Genetics
https://www.readbyqxmd.com/read/29154388/systematic-review-of-the-effect-of-denosumab-on-children-with-osteogenesis-imperfect-showed-inconsistent-findings
#3
Guowei Li, Yanling Jin, Mitchell A H Levine, Heike Hoyer-Kuhn, Leanne Ward, Jonathan D Adachi
Osteogenesis imperfecta (OI) is a rare, inherited disorder characterised by increased bone fragility, reduced bone mass and often short stature. Most cases are due to mutations in one of the two genes encoding collagen type-1 - COL1A1 and COL1A2 (1) - and the signs and symptoms vary substantially with the disease severity. The risk of fractures is 100 times higher than the general population, even in patients with mild OI. Bisphosphonates are the current standard pharmacotherapy for managing and treating patients with severe OI, but concerns about their long-term safety have been raised (1)...
November 20, 2017: Acta Paediatrica
https://www.readbyqxmd.com/read/29150909/genetic-analysis-of-osteogenesis-imperfecta-in-the-palestinian-population-molecular-screening-of-49-affected-families
#4
Osama Essawi, Sofie Symoens, Maha Fannana, Mohammad Darwish, Mohammad Farraj, Andy Willaert, Tamer Essawi, Bert Callewaert, Anne De Paepe, Fransiska Malfait, Paul J Coucke
BACKGROUND: Osteogenesis imperfecta (OI) is a heterogeneous hereditary connective tissue disorder clinically hallmarked by increased susceptibility to bone fractures. METHODS: We analyzed a cohort of 77 diagnosed OI patients from 49 unrelated Palestinian families. Next-generation sequencing technology was used to screen a panel of known OI genes. RESULTS: In 41 probands, we identified 28 different disease-causing variants of 9 different known OI genes...
November 18, 2017: Molecular Genetics & Genomic Medicine
https://www.readbyqxmd.com/read/29109886/radiofrequency-targeted-vertebral-augmentation-case-report-of-a-patient-with-7-osteoporotic-vertebral-fractures-in-a-variant-of-osteogenesis-imperfecta
#5
Leonard Westermann, Peer Eysel, Marvin Simons, Kourosh Zarghooni
Introduction: Radiofrequency-targeted vertebral augmentation (RF-TVA) is a recognized treatment for painful compression fractures. RF-TVA in a patient with multiple compression fractures due to type I osteogenesis imperfecta (OI) has not been previously reported. Case Presentation: A 54-year-old patient with type I OI is presented with a segmental thoracic hyperkyphosis and 7 recent vertebral compression fractures. Because of persistent severe thoracolumbar back pain despite conservative therapy, RF-TVA was indicated...
2017: Case Reports in Orthopedics
https://www.readbyqxmd.com/read/29107738/extracellular-vesicles-released-from-mesenchymal-stromal-cells-stimulate-bone-growth-in-osteogenesis-imperfecta
#6
Satoru Otsuru, Laura Desbourdes, Adam J Guess, Ted J Hofmann, Theresa Relation, Takashi Kaito, Massimo Dominici, Masahiro Iwamoto, Edwin M Horwitz
BACKGROUND: Systemic infusion of mesenchymal stromal cells (MSCs) has been shown to induce acute acceleration of growth velocity in children with osteogenesis imperfecta (OI) despite minimal engraftment of infused MSCs in bones. Using an animal model of OI we have previously shown that MSC infusion stimulates chondrocyte proliferation in the growth plate and that this enhanced proliferation is also observed with infusion of MSC conditioned medium in lieu of MSCs, suggesting that bone growth is due to trophic effects of MSCs...
October 26, 2017: Cytotherapy
https://www.readbyqxmd.com/read/29104038/extremely-low-level-of-serum-pigment-epithelium-derived-factor-is-a-special-biomarker-of-chinese-osteogenesis-imperfecta-patients-with-serpinf1-mutations
#7
Jian-Yi Wang, Lu-Jiao Li, Qian Zhang, Yi Liu, Fang Lv, Xiao-Jie Xu, Yu-Wen Song, Ou Wang, Yan Jiang, Wei-Bo Xia, Xiao-Ping Xing, Mei Li
BACKGROUNDS: SERPINF1 mutations caused deficiency of pigment epithelium-derived factor (PEDF) and would lead to osteogenesis imperfecta (OI) type VI. However, serum PEDF levels were unclear in Chinese OI patients who had clear molecular diagnosis. OBJECTIVE: To assess PEDF levels in different genotypes of OI, to evaluate the influencing factors of PEDF in Chinese OI patients with clear molecular diagnosis. METHODS: Known candidate genes of OI were examined by a targeted next generation sequence...
November 2, 2017: Clinica Chimica Acta; International Journal of Clinical Chemistry
https://www.readbyqxmd.com/read/29101475/insight-into-the-pathology-of-a-col1a1-signal-peptide-heterozygous-mutation-leading-to-severe-osteogenesis-imperfecta
#8
U Lindert, M Gnoli, M Maioli, M F Bedeschi, L Sangiorgi, M Rohrbach, C Giunta
Osteogenesis imperfecta or "brittle bone disease" is a congenital disorder of connective tissue causing the bone to break easily. Around 85-90% of cases are due to autosomal dominant mutations in the genes encoding type I collagen, the major organic component of bone. Genotype-phenotype correlations have shown that quantitative defects of collagen type I lead to mild OI, whereas structural defects show a wide clinical range from mild to perinatal lethal. This may partially be explained by the type of amino acid substitution and the relative location in the domain structure...
November 3, 2017: Calcified Tissue International
https://www.readbyqxmd.com/read/29098346/correction-to-gene-mutation-spectrum-and-genotype-phenotype-correlation-in-a-cohort-of-chinese-osteogenesis-imperfecta-patients-revealed-by-targeted-next-generation-sequencing
#9
Y Liu, Asan, D Ma, F Lv, X Xu, J Wang, W Xia, Y Jiang, O Wang, X Xing, W Yu, J Wang, J Sun, L Song, Y Zhu, H Yang, J Wang, M Li
In Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).
November 2, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29089584/acvr2b-fc-counteracts-chemotherapy-induced-loss-of-muscle-and-bone-mass
#10
Rafael Barreto, Yukiko Kitase, Tsutomu Matsumoto, Fabrizio Pin, Kyra C Colston, Katherine E Couch, Thomas M O'Connell, Marion E Couch, Lynda F Bonewald, Andrea Bonetto
Chemotherapy promotes the development of cachexia, a debilitating condition characterized by muscle and fat loss. ACVR2B/Fc, an inhibitor of the Activin Receptor 2B signaling, has been shown to preserve muscle mass and prolong survival in tumor hosts, and to increase bone mass in models of osteogenesis imperfecta and muscular dystrophy. We compared the effects of ACVR2B/Fc on muscle and bone mass in mice exposed to Folfiri. In addition to impairing muscle mass and function, Folfiri had severe negative effects on bone, as shown by reduced trabecular bone volume fraction (BV/TV), thickness (Tb...
October 31, 2017: Scientific Reports
https://www.readbyqxmd.com/read/29051885/the-reversed-less-invasive-stabilisation-system-distal-femur-technique-application-in-an-adult-patient-with-osteogenesis-imperfecta-sustaining-a-femoral-fracture
#11
Markus S Hanke, Marius Johann Keel, Inga A Todorski, Johannes Dominik Bastian
INTRODUCTION: The aim of this study was to report the surgical management and to discuss the options for fracture fixation in an adult patient with osteogenesis imperfecta (OI) who sustained a trochanteric femoral fracture after a simple fall from standing position. CASE REPORT: As a result of multiple fractures during childhood, this adult patient with OI presented with a short stature. The radiographs revealed a displaced, intertrochanteric fracture with subtrochanteric extension of the left femur...
May 2017: Journal of Orthopaedic Case Reports
https://www.readbyqxmd.com/read/29051883/early-motor-delay-an-outstanding-initial-sign-of-osteogenesis-imperfecta-type-1
#12
Vito Pavone, Teresa Mattina, Piero Pavone, Raffaele Falsaperla, Gianluca Testa
INTRODUCTION: Osteogenesis imperfect (OI) is a heterogeneous and complex connective tissue disorder that manifests with low bone density and fragility. More than 15 types of OI have been distinguished on a clinical and molecular basis, but the classical clinical classification previously proposed in Types 1-4 with the recent inclusion of Type 5 appears to be more suitable. The diagnosis is mainly made on clinical and radiographic findings with fractures caused by mild trauma, bowing deformities of long bones, and growth deficiency...
May 2017: Journal of Orthopaedic Case Reports
https://www.readbyqxmd.com/read/29044725/serum-sclerostin-levels-in-adults-with-osteogenesis-imperfecta-comparison-with-normal-individuals-and-response-to-teriparatide-therapy
#13
Lindsey Nicol, Ying Wang, Rosamund Smith, John Sloan, Sandesh C S Nagamani, Jay Shapiro, Brendan Lee, Eric Orwoll
Sclerostin (SOST), a glycoprotein primarily derived from osteocytes, is an important regulator of bone remodeling. Osteogenesis imperfecta ([1]) is a heritable disorder of bone characterized by low bone mass, bone fragility, recurrent fractures, and bone deformities. Altered SOST-mediated signaling may have a role in pathogenesis of type I collagen-related OI; however this has not been evaluated in humans. We measured serum SOST levels in adults with OI who were enrolled in a randomized, placebo-controlled clinical trial that evaluated the effects of osteoanabolic therapy with teriparatide...
October 17, 2017: Journal of Bone and Mineral Research: the Official Journal of the American Society for Bone and Mineral Research
https://www.readbyqxmd.com/read/29037585/iatrogenic-mandibular-fracture-after-open-reduction-and-internal-fixation-in-a-patient-with-osteogenesis-imperfecta
#14
M-Y Kim, C-H Kim
To the best of our knowledge, this is the first report to discuss the possible mechanisms of an iatrogenic fracture during operation on an original mandibular fracture in a patient with osteogenesis imperfecta.
October 13, 2017: British Journal of Oral & Maxillofacial Surgery
https://www.readbyqxmd.com/read/29036614/identification-of-a-candidate-mutation-in-the-col1a2-gene-of-a-chow-chow-with-osteogenesis-imperfecta
#15
E M Quist, R Doan, R R Pool, B F Porter, D L Bannasch, S V Dindot
Osteogenesis imperfecta (OI) is a genetic disease that occurs in humans and animals. Individuals with OI exhibit signs of extreme bone fragility and osteopenia with frequent fractures and perinatal lethality in severe cases. In this study, we report the clinical diagnosis of OI in a dog and the use targeted next-generation sequencing to identify a candidate autosomal dominant mutation in the COL1A2 gene. A five-month old male Chow Chow was examined with a fractured left humerus and resolving, bilateral femoral fractures...
September 19, 2017: Journal of Heredity
https://www.readbyqxmd.com/read/29021887/a-modified-technique-of-fixation-for-proximal-femoral-valgus-osteotomy-in-abnormal-bone-a-report-of-two-cases
#16
S Logheswaren, A R Sulaiman, I Munajat
The ideal size of intramedullary device to fix corrective osteotomy of proximal femur in abnormal bone in children and small patients may not be easily available. We report the successful use of Rush rod in combination with multiple Kirschner wires to fix the corrective osteotomy of coxa vara and shepherd crook deformity in two patients with osteogenesis imperfecta and fibrous dysplasia. The union was achieved on time, neck shaft angle and rotation were maintained.
July 2017: Malaysian Orthopaedic Journal
https://www.readbyqxmd.com/read/28988680/macroscopic-anisotropic-bone-material-properties-in-children-with-severe-osteogenesis-imperfecta
#17
Carolyne Albert, John Jameson, Sergey Tarima, Peter Smith, Gerald Harris
Children with severe osteogenesis imperfecta (OI) typically experience numerous fractures and progressive skeletal deformities over their lifetime. Recent studies proposed finite element models to assess fracture risk and guide clinicians in determining appropriate intervention in children with OI, but lack of appropriate material property inputs remains a challenge. This study aimed to characterize macroscopic anisotropic cortical bone material properties and investigate relationships with bone density measures in children with severe OI...
September 14, 2017: Journal of Biomechanics
https://www.readbyqxmd.com/read/28988216/efficacy-and-treatment-costs-of-zoledronate-versus-pamidronate-in-paediatric-osteoporosis
#18
Vrinda Saraff, Jaskiran Sahota, Nicola Crabtree, Sophia Sakka, Nicholas J Shaw, Wolfgang Högler
Intravenous pamidronate has been used in the treatment of osteogenesis imperfecta (OI) in children for over 20 years. The more potent zoledronate is an attractive alternative as it is administered less frequently. This study compares the clinical efficacy of intravenous pamidronate (1.5 mg/kg/day over 2 days, every 3 months) versus zoledronate (0.05 mg/kg/dose every 6 months) in 40 children (20 per group) with mild to moderate OI and the treatment costs of the two drugs in a tertiary centre for children with osteoporosis...
October 7, 2017: Archives of Disease in Childhood
https://www.readbyqxmd.com/read/28981938/-mutational-analysis-and-prenatal-diagnosis-of-col1a1-and-col1a2-genes-in-four-chinese-families-affected-with-osteogenesis-imperfecta
#19
Ying Bai, Xiangdong Kong, Ning Liu, Shumin Ren, Hongxiang Guo, Kaihui Zhao
OBJECTIVE: To detect potential mutations of COL1A1 and COL1A2 genes in four Chinese pedigrees affected with osteogenesis imperfecta (OI) and provide prenatal diagnosis for a fetus at 18th gestational week. METHODS: All coding regions and exon/intron boundaries of the COL1A1 and COL1A2 genes were analyzed with targeted next-generation sequencing (NGS). Suspected mutations were confirmed with Sanger sequencing in the probands, unaffected relatives and 200 unrelated healthy individuals...
October 10, 2017: Zhonghua Yi Xue Yi Chuan Xue za Zhi, Zhonghua Yixue Yichuanxue Zazhi, Chinese Journal of Medical Genetics
https://www.readbyqxmd.com/read/28979858/using-humeral-nail-for-surgical-reconstruction-of-femur-in-adolescents-with-osteogenesis-imperfecta
#20
Paphon Sa-Ngasoongsong, Tanyawat Saisongcroh, Chanika Angsanuntsukh, Patarawan Woratanarat, Pornchai Mulpruek
Osteogenesis imperfecta (OI) is a rare inherited connective tissue disorder caused by mutation of collagen which results in a wide spectrum of clinical manifestations including long bone fragility fractures and deformities. While the treatment for these fractures was recommended as using intramedullary fixation for minimizing stress concentration, the selection of the best implant in the adolescent OI patients for the surgical reconstruction of femur was still problematic, due to anatomy distortion and implant availability...
September 18, 2017: World Journal of Orthopedics
keyword
keyword
3264
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"