keyword
MENU ▼
Read by QxMD icon Read
search

Nature medicine

keyword
https://www.readbyqxmd.com/read/28727990/new-heterocyclic-compounds-from-ranunculus-ternatus-thunb
#1
Zi-Ming Feng, Zhi-Lai Zhan, Ya-Nan Yang, Jian-Shuang Jiang, Pei-Cheng Zhang
Five new heterocyclic compounds, 5-α-d-fructofuranosylmethyl-furfural (1), 5-β-d-fructofuranosylmethyl-furfural (2), 5-β-d-fructopyranosylmethyl-furfural (3), 4-(2-((2S-2,3-dihydroxypropoxy)methyl)-5-formyl-1H-pyrrol-1-yl)butanoic acid (4), and 3S,4S-4,5,8-trihydroxy-3-(prop-1-en-2-yl)isochroman-1-one (5), were obtained from the root of Ranunculus ternatus Thunb., which is a traditional Chinese anti-tuberculosis medicine. Their structures were elucidated by UV, IR, HRESIMS, NMR data, and the comparison of experimental and calculated electronic circular dichroism (ECD) spectra...
July 12, 2017: Bioorganic Chemistry
https://www.readbyqxmd.com/read/28727700/therapeutic-role-of-placebo-evolution-of-a-new-paradigm-in-understanding-research-and-clinical-practice
#2
Laxmaiah Manchikanti, Mark V Boswell, Alan D Kaye, Standiford Helm Ii, Joshua A Hirsch
Research into interventional techniques in managing chronic spinal pain continues to be challenging, mystifying, confusing, and biased. Insight, or lack thereof, into placebo and nocebo phenomena contributes mightily to these difficulties. Unfortunately, placebo-nocebo responses are the subject of numerous controversies and challenges from not only a research perspective, but also clinical perspective. While interventionalists consider the biggest threat to interventional pain management research is inappropriate and outdated interpretation of the data, a greater problem is the misuse of the placebo response in research, with the declaration that all and everything as a placebo effect: with a misinterpretation of the nature of the placebo the, associated conclusions can be inaccurate...
July 2017: Pain Physician
https://www.readbyqxmd.com/read/28727174/alkaline-phosphatase-discovery-and-naming-of-our-favorite-enzyme
#3
Alejandro F Siller, Michael P Whyte
Alkaline phosphatase can be considered "our favorite enzyme" for reasons apparent to those who diagnose and treat metabolic bone diseases or who study skeletal biology. Few might know, however, that alkaline phosphatase likely represents the most frequently assayed enzyme in all of Medicine. Elevated activity in the circulation is universally recognized as a marker for skeletal or hepatobiliary disease. Nevertheless, the assay conditions in many ways are non-physiological. The term alkaline phosphatase emerged when it became necessary to distinguish "bone phosphatase" from the phosphatase in the prostate that features an acidic pH optimum...
July 20, 2017: Journal of Bone and Mineral Research: the Official Journal of the American Society for Bone and Mineral Research
https://www.readbyqxmd.com/read/28726934/clove-extract-functions-as-a-natural-fatty-acid-synthesis-inhibitor-and-prevents-obesity-in-a-mouse-model
#4
Yiran Ding, Zhennan Gu, Yihe Wang, Shunhe Wang, Haiqin Chen, Hao Zhang, Wei Chen, Yong Q Chen
Numerous medicinal plants have been reported to prevent various chronic diseases. In this study, we screened a new FASN inhibitor-alcohol extract of clove (AEC) using a fast microplate method developed in our laboratory. The major components of AEC were: eugenol (42.27%), acetyl eugenol (29.12%), caryophyllene (15.40%), and humulene (3.22%). Fatty acid synthase (FASN) is a key enzyme for de novo lipogenesis, and it has been suggested as a potential therapeutic target in cancer and obesity. We have tested the ability of AEC to inhibit FASN in mammalian cells and tissues...
July 20, 2017: Food & Function
https://www.readbyqxmd.com/read/28725632/medicinal-importance-pharmacological-activities-and-analytical-aspects-of-hispidulin-a-concise-report
#5
REVIEW
Kanika Patel, Dinesh Kumar Patel
Herbal medicines have been played an important role in the human civilization since very ancient time as a food, cloth, medicine and other aspects. Some of the important drugs in the modern medicine were derived from the natural sources such as aspirin, digitalis, quinine, vincristine, vinblastine etc. Hispidulin (4', 5, 7-trihydroxy-6-methoxyflavone) is a flavones derivative found in plant such as Grindelia argentina, Arrabidaea chica, Saussurea involucrate, Crossostephium chinense, Artemisia and Salvia species...
July 2017: Journal of Traditional and Complementary Medicine
https://www.readbyqxmd.com/read/28725630/curcumin-an-age-old-anti-inflammatory-and-anti-neoplastic-agent
#6
REVIEW
Matthew C Fadus, Cecilia Lau, Jai Bikhchandani, Henry T Lynch
Curcumin is a natural anti-inflammatory agent that has been used for treating medical conditions for many years. Several experimental and pharmacologic trials have demonstrated its efficacy in the role as an anti-inflammatory agent. Curcumin has been shown to be effective in treating chronic conditions like rheumatoid arthritis, inflammatory bowel disease, Alzheimer's and common malignancies like colon, stomach, lung, breast, and skin cancers. As treatments in medicine become more and more complex, the answer may be something simpler...
July 2017: Journal of Traditional and Complementary Medicine
https://www.readbyqxmd.com/read/28725623/isolation-and-characterization-of-antimicrobial-compound-from-the-stem-bark-of-the-traditionally-used-medicinal-plant-adenium-obesum
#7
Mohammed Sohail Akhtar, Mohammad Amzad Hossain, Sadri Abdullah Said
BACKGROUND: Medicinal plants constitute a natural reservoir for medicines worldwide. They serve mainstream therapeutics and are central in folklore medicine. In case of Adenium obesum (Lav, Apocynaceae), indigenous people of Oman use it for the treatment of venereal diseases, wounds, skin diseases, headaches, muscle pain as well as joint pain; yet, the active ingredients have not been classified. To screened the antioxidant and antimicrobial activities of an identified compound that we isolated from the highest active chloroform extract...
July 2017: Journal of Traditional and Complementary Medicine
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#8
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28724420/legal-access-to-medications-a-threat-to-brazil-s-public-health-system
#9
Ana Luiza Chieffi, Rita De Cassia Barata Barradas, Moisés Golbaum
BACKGROUND: In Brazil, health is fundamental human right guaranteed by the Constitution of 1988, which created the Brazilian Universal Health System (Sistema Único de Saúde - SUS). The SUS provides medications for outpatient care via policy of pharmaceutical assistance (PA) programmes. Despite the advances in PA policies which include the improvement in access to medications, there has been a significant increase in lawsuits related to health products and services. This study aimed to characterize the medication processes filed between 2010 and 2014 against the Secretary of State for Health of São Paulo (State Health Department of São Paulo - SES/SP), in Brazil, following PA policies...
July 19, 2017: BMC Health Services Research
https://www.readbyqxmd.com/read/28724259/herbal-pre-conditioning-induces-proliferation-and-delays-senescence-in-wharton-s-jelly-mesenchymal-stem-cells
#10
Avinash Sanap, Bhawna Chandravanshi, Tejas Shah, Girish Tillu, Anand Dhanushkodi, Ramesh Bhonde, Kalpana Joshi
BACKGROUND: Mesenchymal Stem Cells (MSCs) are multipotent stem cells which are being explored for various clinical applications. Isolation and in-vitro expansion of MSCs remain important in achieving desired cell number for the therapy. However, in-vitro proliferation of MSCs is often associated with senescence and early onset of apoptosis which limits its therapeutic ability and long term clinical use. Tinospora cordifolia and Withania somnifera are used widely in Ayurveda: the traditional Indian system of medicine and are reported to have rejuvenating and anti-aging potential...
July 15, 2017: Biomedicine & Pharmacotherapy, Biomédecine & Pharmacothérapie
https://www.readbyqxmd.com/read/28724199/antidiabetic-potential-in-vitro-inhibition-effects-of-some-natural-phenolic-compounds-on-%C3%AE-glycosidase-and-%C3%AE-amylase-enzymes
#11
Parham Taslimi, İlhami Gulçin
α-Glycosidase is a catalytic enzyme and it destroys the complex carbohydrates into simple absorbable sugar units. The natural phenolic compounds were tested for their antidiabetic properties as α-glycosidase and α-amylase inhibitors. The phenolic compounds investigated in this study have been used as antidiabetic common medicines. This paper aimed to consider their capability to inhibit α-amylase and α-glycosidase, two significant enzymes defined in serum glucose adjustment. These examination recorded impressive inhibition profiles with IC50 values in the range of 137...
July 19, 2017: Journal of Biochemical and Molecular Toxicology
https://www.readbyqxmd.com/read/28724020/the-home-care-teaching-and-learning-process-in-undergraduate-health-care-degree-courses
#12
Ana Paula Hermann, Maria Ribeiro Lacerda, Mariluci Alves Maftum, Elizabeth Bernardino, Ana Lúcia Schaefer Ferreira de Mello
Home care, one of the services provided by the health system, requires health practitioners who are capable of understanding its specificities. This study aimed to build a substantive theory that describes experiences of home care teaching and learning during undergraduate degree courses in nursing, pharmacy, medicine, nutrition, dentistry and occupational therapy. A qualitative analysis was performed using the grounded theory approach based on the results of 63 semistructured interviews conducted with final year students, professors who taught subjects related to home care, and recent graduates working with home care, all participants in the above courses...
July 2017: Ciência & Saúde Coletiva
https://www.readbyqxmd.com/read/28723939/assessing-health-related-resiliency-in-hiv-latin-women-preliminary-psychometric-findings
#13
Gladys J Jimenez-Torres, Valerie Wojna, Ernesto Rosario, Rosa Hechevarría, Ada M Alemán-Batista, Miriam Ríos Matos, Alok Madan, Richard L Skolasky, Summer F Acevedo
BACKGROUND: HIV-associated vulnerabilities-especially those linked to psychological issues-and limited mental health-treatment resources have the potential to adversely affect the health statuses of individuals. The concept of resilience has been introduced in the literature to shift the emphasis from vulnerability to protective factors. Resilience, however, is an evolving construct and is measured in various ways, though rarely among underserved, minority populations. Herein, we present the preliminary psychometric properties of a sample of HIV-seropositive Puerto Rican women, measured using a newly developed health-related resilience scale...
2017: PloS One
https://www.readbyqxmd.com/read/28723868/screening-of-medicinal-plant-phytochemicals-as-natural-antagonists-of-p53-mdm2-interaction-to-reactivate-p53-functioning
#14
Muhammad Riaz, Usman A Ashfaq, Muhammad Qasim, Erum Yasmeen, Muhammad T Ul Qamar, Farooq Anwar
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix...
July 18, 2017: Anti-cancer Drugs
https://www.readbyqxmd.com/read/28723722/complementary-and-alternative-medicine-use-and-symptom-burden-in-women-undergoing-chemotherapy-for-breast-cancer-in-malaysia
#15
Ping Lei Chui, Khatijah Lim Abdullah, Li Ping Wong, Nur Aishah Taib
BACKGROUND: Complementary and alternative medicine (CAM) is commonly used for cancer- and chemotherapy-related symptoms. Nurses are likely to encounter many CAM users in their practice. OBJECTIVE: The aims of this study were to assess CAM use and examine the symptom burden of CAM and non-CAM users among patients with breast cancer who are undergoing chemotherapy. METHODS: A CAM use questionnaire and the Side-Effect Burden Scale were administered to 546 patients...
July 14, 2017: Cancer Nursing
https://www.readbyqxmd.com/read/28723615/nanoformulations-of-curcumin-an-emerging-paradigm-for-improved-remedial-application
#16
REVIEW
Meeta Gera, Neelesh Sharma, Mrinmoy Ghosh, Do Luong Huynh, Sung Jin Lee, Taesun Min, Taeho Kwon, Dong Kee Jeong
Curcumin is a natural polyphenol and essential curcuminoid derived from the rhizome of the medicinal plant Curcuma longa (L.) is universally acknowledged as "Wonder drug of life". It is a vital consumable and restorative herb, commonly keened for several ailments such as cancer, arthritis, pain, bruises, gastrointestinal quandaries, swelling and much more. Despite its enormous curative potential, the poor aqueous solubility and consequently, minimal systemic bioavailability with rapid degradation are some of the major factors which restrict the utilization of curcumin at medical perspective...
July 11, 2017: Oncotarget
https://www.readbyqxmd.com/read/28723545/spineless-behavior-of-cx3cr1-monocytes-in-response-to-infection
#17
Paul A Muller, Daniel Mucida
Sickness in mammals can lead to cognition deficits, although the underlying mechanisms remain elusive. In a recent Nature Medicine article, Garré et al. (2017) report that sickness-induced cortical dendritic spine loss and impaired memory formation is mediated by CX3CR1(+) monocyte-derived TNF-α.
July 18, 2017: Immunity
https://www.readbyqxmd.com/read/28722478/rho-kinase-inhibitors-from-adlay-seeds
#18
Yhiya Amen, Qinchang Zhu, Hai-Bang Tran, Mohamed S Afifi, Ahmed F Halim, Ahmed Ashour, Ryoji Fujimoto, Takahiro Goto, Kuniyoshi Shimizu
Rho-kinase enzymes are one of the most important targets recently identified in our bodies. Several lines of evidence indicate that these enzymes are involved in many diseases and cellular disorders. ROCK inhibitors may have clinical applications for cancer, hypertension, glaucoma, etc. Our study aims to identify the possible involvement of Rho-kinase inhibition to the multiple biological activities of adlay seeds and provide a rationale for their folkloric medicines. Hence, we evaluated Rho-kinase I and II inhibitory activity of the ethanol extract and 28 compounds derived from the seeds...
July 19, 2017: Natural Product Research
https://www.readbyqxmd.com/read/28722469/recent-advances-in-gossypol-derivatives-and-analogs-a-chemistry-and-biology-view
#19
Yuzhi Lu, Jun Li, Chun-E Dong, Jian Huang, Hai-Bing Zhou, Wei Wang
Gossypol as a natural occurring polyphenol has been studied in a wide range of therapeutic contexts for a long time. The chemical modifications on gossypol were limited due to the unique chemical properties of polyphenols. The design and synthesis of gossypol derivatives and the exploration of their biological activities are the interest of the synthetic chemists, medicinal chemists and pharmacologists. Thus, the progress of diverse gossypol derivatives and analogs' synthesis, biological activities, mechanism elucidation and drug discovery based on gossypol scaffold is summarized...
July 19, 2017: Future Medicinal Chemistry
https://www.readbyqxmd.com/read/28722215/synthesis-of-cyclic-peptide-mimetics-via-the-successive-ring-expansion-of-lactams
#20
Thomas C Stephens, Mahendar Lodi, Andrew M Steer, Yun Lin, Matthew T Gill, William Paul Unsworth
A successive ring expansion protocol is reported that enables the controlled insertion of natural and non-natural amino acid fragments into lactams. Amino acids can be installed into macrocycles via an operationally simple and scalable iterative procedure, without the need for high dilution. This method is expected to be of broad utility, especially for the synthesis of medicinally important cyclic peptide mimetics.
July 19, 2017: Chemistry: a European Journal
keyword
keyword
26681
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"