keyword
MENU ▼
Read by QxMD icon Read
search

Authenticity

keyword
https://www.readbyqxmd.com/read/28738573/stable-isotope-ratio-analysis-for-authentication-of-red-yeast-rice
#1
Matteo Perini, Gianfranco Carbone, Federica Camin
Red yeast rice (RYR) is a dietary supplement obtained from rice fermented with the mould Monascus purpureus. It contains Monacolin K which is a hypocholesterolemic statin used to prevent cardiovascular diseases. The homologous prescription biosynthetic statin, lovastatin, is not chemically distinguishable from monacolin K. In this work we investigated whether δ(13)C and δ(2)H can distinguish monacolin K from lovastatin and can detect the presence of lovastatin in RYR. 18 samples of red yeast rice powder and 18 samples of lovastatin were collected...
November 1, 2017: Talanta
https://www.readbyqxmd.com/read/28738440/issr-derived-species-specific-scar-marker-for-rapid-and-accurate-authentication-of-ocimum-tenuiflorum-l
#2
Amit Kumar, Vereena Rodrigues, Priyanka Mishra, Kuppusamy Baskaran, Ashutosh K Shukla, Ajit K Shasany, Velusamy Sundaresan
Ocimum tenuiflorum has been widely used in traditional medicine and has high medicinal value. High volume trade of this potential medicinal plant species led to unscrupulous adulteration of both crude drugs as well as formulations. Morphology-based authentication is difficult in cases of incomplete or damaged samples and in dried herbal materials. In such cases, PCR-based molecular methods may aid in accurate identification. The present study aimed at developing species-specific DNA marker(s) for the authentication of O...
July 24, 2017: Planta Medica
https://www.readbyqxmd.com/read/28737938/heterogeneous-photooxidation-of-so2-in-the-presence-of-two-different-mineral-dust-particles-gobi-and-arizona-dust
#3
Jiyeon Park, Myoseon Jang, Zechen Yu
The impact of authentic mineral dust particles sourced from the Gobi Desert (GDD) on the kinetic uptake coefficient of SO2 was studied under varying environments (humidity, O3, and NOx) using both an indoor chamber and an outdoor chamber. There was a significant increase in the kinetic uptake coefficient of SO2 (ΥSO4(2-),light) for GDD particles under UV light compared to the value (ΥSO4(2-),dark) under dark conditions at various relative humidities (RH) ranging from 20% to 80%. In both the presence and absence of O3 and NOx, ΥSO4(2-),light and ΥSO4(2-),dark) greatly increased with increasing RH...
July 24, 2017: Environmental Science & Technology
https://www.readbyqxmd.com/read/28737240/in-gel-and-offgel-based-proteomic-approach-for-authentication-of-meat-species-from-minced-meat-and-meat-products
#4
Basappa M Naveena, Deepak S Jagadeesh, Veeranna Kamuni, Muthukumar M, Vinayak V Kulkarni, Kiran M, Srikanth Rapole
BACKGROUND: Fraudulent mislabelling of processed meat products on global scale which could not be detected using conventional techniques demand for sensitive, robust and accurate methods of meat authentication to ensure food safety and public health. In the present study, we developed in-gel (2-dimensional gel electrophoresis, 2DE) and OFFGEL-based proteomic method for authenticating raw and cooked water buffalo (Bubalus bubalis), sheep (Ovis aries) and goat (Caprus hircus) meat and their mixes...
July 24, 2017: Journal of the Science of Food and Agriculture
https://www.readbyqxmd.com/read/28736243/from-insulin-synthesis-to-secretion-alternative-splicing-of-type-2-ryanodine-receptor-gene-is-essential-for-insulin-secretion-in-pancreatic-%C3%AE-cells
#5
Hiroshi Okamoto, Shin Takasawa, Yasuhiko Yamamoto
Increases in the intracellular Ca(2+) concentration in pancreatic islets, resulting from the its mobilization from the intracellular source through the ryanodine receptor, are essential for insulin secretion by glucose. Cyclic ADP-ribose, a potent Ca(2+) mobilizing second messenger synthesized from NAD(+) by CD38, regulates the opening of ryanodine receptor. A novel ryanodine receptor mRNA (the islet-type ryanodine receptor) was found to be generated from the type 2 ryanodine receptor gene by the alternative splicing of exons 4 and 75...
July 20, 2017: International Journal of Biochemistry & Cell Biology
https://www.readbyqxmd.com/read/28734350/dried-urine-spots-a-novel-sampling-technique-for-comprehensive-lc-ms-n-drug-screening
#6
Julian A Michely, Markus R Meyer, Hans H Maurer
Dried matrix spot (DMS) technique as alternative sampling strategy, especially dried urine spots (DUS), might be an alternative for drug screening. So far only particular drugs or drug classes were covered in DMS screenings. Therefore, workup of DUS for a broad comprehensive library-based LC-MS(n) screening was developed. It consisted of enzymatic on-spot deconjugation followed by liquid extraction and LC-MS(n) analysis. This workup was compared to established urine precipitation (UP) and validated according to international guidelines for qualitative approaches, using exemplary compounds of several drug classes (antidepressants, benzodiazepines, cardiovascular drugs, neuroleptics, opioids, stimulants, etc...
August 22, 2017: Analytica Chimica Acta
https://www.readbyqxmd.com/read/28734194/high-yield-one-pot-production-of-18-f-fch-via-a-modified-tracerlab-fxfn-module
#7
Ya-Yao Huang, Chia-Ling Tsai, Hsiang-Ping Wen, Kai-Yuan Tzen, Ruoh-Fen Yen, Chyng-Yann Shiue
INTRODUCTION: [(18)F]Fluoromethylcholine ([(18)F]FCH) is a potent tumors imaging agent. In order to fulfill the demand of pre-clinical and clinical studies, we have developed an automated high yield one-pot synthesis of this potent tumors imaging agent. METHODS: [(18)F]FCH was synthesized using a modified TRACERlab FxFN module. Briefly, dibromomethane (10% in CH3CN) was fluorinated with K[(18)F]/K 2.2.2 in a glassy carbon reaction vessel at 120°C for about 5min to generate [(18)F]fluorobromomethane ([(18)F]FBM)...
July 15, 2017: Applied Radiation and Isotopes
https://www.readbyqxmd.com/read/28734181/evaluating-a-nursing-erasmus-exchange-experience-reflections-on-the-use-and-value-of-the-nominal-group-technique-for-evaluation
#8
Sheila Cunningham
This paper discusses the use of Nominal Group Technique (NGT) for European nursing exchange evaluation at one university. The NGT is a semi-quantitative evaluation method derived from the Delphi method popular in the 1970s and 1980s. The NGT was modified from the traditional version retaining the structured cycles and but adding a broader group discussion. The NGT had been used for 2 successive years but required analysis and evaluation itself for credibility and 'fit' for purpose which is presented here. It aimed to explore nursing students' exchange experiences and aid programme development futures exchanges and closure from exchange...
July 12, 2017: Nurse Education in Practice
https://www.readbyqxmd.com/read/28733969/tailoring-ion-charge-state-distribution-in-tetramethyltin-clusters-under-influence-of-moderate-intensity-picosecond-laser-pulse-role-of-laser-wavelength-and-rate-of-energy-deposition
#9
Pramod Sharma, Soumitra Das, Rajesh K Vatsa
Systematic manipulation of ionic-outcome in laser-cluster interaction process has been realized for studies carried out on tetramethyltin (TMT) clusters under picosecond laser conditions, determined by choice of laser wavelength and intensity. As a function of laser intensity, TMT clusters exhibit gradual enhancement in overall ionization of its cluster constituents, up to a saturation level of ionization, which was distinct for different wavelengths (266, 355, and 532 nm). Simultaneously, systematic appearance of higher multiply charged atomic ions and shift in relative abundance of multiply charged atomic ions towards higher charge state was observed, using time-of-flight mass spectrometer...
July 21, 2017: Journal of the American Society for Mass Spectrometry
https://www.readbyqxmd.com/read/28733298/are-there-patient-related-factors-that-influence-sickness-certification-in-patients-with-severe-subjective-health-complaints-a-cross-sectional-exploratory-study-from-different-european-countries
#10
Suzanne L Merkus, Rob Hoedeman, Silje Mæland, Kristel H N Weerdesteijn, Frederieke G Schaafsma, Maud Jourdain, Jean-Paul Canevet, Cédric Rat, Johannes R Anema, Erik L Werner
OBJECTIVES: To develop hypotheses about whether there are patient-related factors that influence physicians' decision-making that can explain why some patients with severe subjective health complaints (SHCs) are more likely to be granted sick leave than others. DESIGN: Exploratory cross-sectional. SETTING: Assessments of patient-related factors after watching nine authentic video recordings of patients with severe SHC from a Norwegian general practice...
July 21, 2017: BMJ Open
https://www.readbyqxmd.com/read/28732963/ultrasonic-assisted-synthesis-of-znte-nanostructures-and-their-structural-electrochemical-and-photoelectrical-properties
#11
P Ilanchezhiyan, G Mohan Kumar, Fu Xiao, S Poongothai, A Madhan Kumar, C Siva, Sh U Yuldashev, D J Lee, Y H Kwon, T W Kang
Colloidal zinc telluride (ZnTe) nanostructures were successfully processed through a simple and facile ultrasonic (sonochemical) treatment for photoelectronic applications. The particle-like morphological features, phase and nature of valence state of various metal ions existing in ZnTe were examined using electron and X-ray photoelectron spectroscopic tools. Raman spectroscopic measurements revealed the dominance of exciton-phonon coupling and occurrence of TeO2 traces in ZnTe through the corresponding vibrations...
November 2017: Ultrasonics Sonochemistry
https://www.readbyqxmd.com/read/28732953/sonochemical-surface-functionalization-of-exfoliated-ldh-effect-on-textural-properties-co2-adsorption-cyclic-regeneration-capacities-and-subsequent-gas-uptake-for-simultaneous-methanol-synthesis
#12
Collins I Ezeh, Xiani Huang, Xiaogang Yang, Cheng-Gong Sun, Jiawei Wang
To improve CO2 adsorption, amine modified Layered double hydroxide (LDH) were prepared via a two stage process, SDS/APTS intercalation was supported by ultrasonic irradiation and then followed by MEA extraction. The prepared samples were characterised using Scanning electron microscope-Energy dispersive X-ray spectroscopy (SEM-EDX), X-ray Photoelectron Spectroscopy (XPS), X-ray diffraction (XRD), Temperature Programmed Desorption (TPD), Brunauer-Emmett-Teller (BET), and Thermogravimetric analysis (TGA), respectively...
November 2017: Ultrasonics Sonochemistry
https://www.readbyqxmd.com/read/28732687/selective-therapeutic-intervention-a-challenge-against-off-target-effects
#13
Filip Rázga, Veronika Némethová
Despite the massive global spend on biology-driven drug discovery, tackling the issue of side effects and adverse events resulting from drug promiscuity represents a persistent challenge. Although delivering authentic medical innovations today is more complex than ever, minimization of off-target effects should be a priority.
July 18, 2017: Trends in Molecular Medicine
https://www.readbyqxmd.com/read/28732070/characterization-of-human-enterovirus71-virus-like-particles-used-for-vaccine-antigens
#14
Dandan Zhao, Bo Sun, Shiyang Sun, Bin Fu, Chuntian Liu, Dawei Liu, Yanfei Chu, Youlei Ma, Lu Bai, Yongge Wu, Yan Zhou, Weiheng Su, Ali Hou, Linjun Cai, Fei Xu, Wei Kong, Chunlai Jiang
Human enterovirus 71 (EV71) is a major causative pathogen of hand, foot and mouth disease (HFMD) and has caused outbreaks with significant mortality among young children in the Asia-Pacific region in recent years. Towards developing a vaccine for this disease, we have expressed and purified EV71 virus-like particles (VLPs), which resemble the authentic virus in appearance, capsid structure and protein sequence, from insect cells (Sf9) using a multistep chromatography process. We demonstrated intracellular localization of the VLPs in host cells by in situ immunogold detection, electron microscopy and immunofluorescence...
2017: PloS One
https://www.readbyqxmd.com/read/28727643/improving-early-adolescent-girls-motor-skill-a-cluster-randomized-controlled-trial
#15
Natalie Lander, Philip J Morgan, Jo Salmon, Lisa M Barnett
BACKGROUND: Physical activity (PA) levels decline substantially during adolescence, and are consistently lower in girls. Competency in a range of fundamental movement skills (FMS) may serve as a protective factor for the decline in PA typically observed in adolescent girls; yet, girls' mastery in FMS is low. Whilst interventions can improve FMS, there is a lack of interventions targeting girls, and very few are conducted in high schools. Additionally, interventions are usually conducted by researchers, not teachers, and thus have little chance of being embedded into curricula...
July 19, 2017: Medicine and Science in Sports and Exercise
https://www.readbyqxmd.com/read/28726362/early-hypertension-after-vasopressor-weaning-during-septic-shock-associated-factors-and-prognostic-significance
#16
Rostane Gaci, Jérémie Lemarie, Marie Conrad, Aurélie Cravoisy, Pierre E Bollaert, Sébastien Gibot
BACKGROUND: During septic shock, early development of hypertension after vasopressors weaning seems paradoxical. The aim of this study was to authenticate this empirical observation, identify associated factors and document its prognostic significance. METHODS: We conducted a descriptive, retrospective study in a medical ICU of a teaching hospital among adult patients with septic shock. RESULTS: From 01.01.2013 to 31.12.2014, 262 consecutive patients over 18 years of age were admitted because of septic shock; 195 of them were successfully weaned from vasopressors...
July 20, 2017: Minerva Anestesiologica
https://www.readbyqxmd.com/read/28725622/authentication-of-piper-betle-l-folium-and-quantification-of-their-antifungal-activity
#17
I Made Agus Gelgel Wirasuta, I Gusti Ayu Made Srinadi, Ida Bagus Gede Dwidasmara, Ni Luh Putu Putri Ardiyanti, I Gusti Ayu Arya Trisnadewi, Ni Luh Putu Vidya Paramita
The TLC profiles of intra- and inter-day precision for Piper betle L. (PBL) folium methanol extract was studied for their peak marker recognition and identification. The Numerical chromatographic parameters (NCPs) of the peak markers, the hierarchical clustering analysis (HCA) and the principal component analysis (PCA) were applied to authenticate the PBL. folium extract from other Piper species folium extract and to ensure the antifungal activity quality of the PBL essential oil. The spotted extract was developed with the mobile phase of toluene: ethyl acetate; 93:7, (v/v)...
July 2017: Journal of Traditional and Complementary Medicine
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#18
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28722604/classification-and-visualization-of-physical-and-chemical-properties-of-falsified-medicines-with-handheld-raman-spectroscopy-and-x-ray-computed-tomography
#19
Tomoko Kakio, Naoko Yoshida, Susan Macha, Kazunobu Moriguchi, Takashi Hiroshima, Yukihiro Ikeda, Hirohito Tsuboi, Kazuko Kimura
Analytical methods for the detection of substandard and falsified medical products (SFs) are important for public health and patient safety. Research to understand how the physical and chemical properties of SFs can be most effectively applied to distinguish the SFs from authentic products has not yet been investigated enough. Here, we investigated the usefulness of two analytical methods, handheld Raman spectroscopy (handheld Raman) and X-ray computed tomography (X-ray CT), for detecting SFs among oral solid antihypertensive pharmaceutical products containing candesartan cilexetil as an active pharmaceutical ingredient (API)...
June 19, 2017: American Journal of Tropical Medicine and Hygiene
https://www.readbyqxmd.com/read/28721842/rapid-seafood-species-identification-using-chip-based-capillary-electrophoresis-and-protein-pattern-matching
#20
Calvin Walker, Cheryl Lassitter, Shannara Lynn, Courtney Ford, Kevin Rademacher, Angela Ruple, Jon Bell
Authenticity is crucial to the seafood industry, as substitution and mislabeling have important economic, environmental, and food safety consequences. To address this problem, protein profiling and software algorithm techniques were developed to classify fish muscle samples by species. The method uses water-based protein extraction, chip-based microfluidic electrophoresis (Agilent 2100 Bioanalyzer) for the analysis of high abundance fish muscle proteins, and a novel data analysis method for species-specific protein pattern recognition...
July 19, 2017: Journal of AOAC International
keyword
keyword
24463
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"