keyword
MENU ▼
Read by QxMD icon Read
search

Quality assurance

keyword
https://www.readbyqxmd.com/read/28734906/results-from-15years-of-quality-surveillance-for-a-national-indigenous-point-of-care-testing-program-for-diabetes
#1
Mark Shephard, Anne Shephard, Bridgit McAteer, Tamika Regnier, Kristina Barancek
INTRODUCTION: Diabetes is a major health problem for Australia's Aboriginal and Torres Strait Islander peoples. Point-of-care testing for haemoglobin A1c (HbA1c) has been the cornerstone of a long-standing program (QAAMS) to manage glycaemic control in Indigenous people with diabetes and recently, to diagnose diabetes. METHODS: The QAAMS quality management framework includes monthly testing of quality control (QC) and external quality assurance (EQA) samples. Key performance indicators of quality include imprecision (coefficient of variation [CV%]) and percentage acceptable results...
July 19, 2017: Clinical Biochemistry
https://www.readbyqxmd.com/read/28733189/systematic-review-of-serum-steroid-reference-intervals-developed-using-mass-spectrometry
#2
REVIEW
Nevada Tavita, Ronda F Greaves
The aim of this study was to perform a systematic review of the published literature to determine the available serum/plasma steroid reference intervals generated by mass spectrometry (MS) methods across all age groups in healthy subjects and to suggest recommendations to achieve common MS based reference intervals for serum steroids. MEDLINE, EMBASE and PubMed databases were used to conduct a comprehensive search for English language, MS-based reference interval studies for serum/plasma steroids. Selection of steroids to include was based on those listed in the Royal College of Pathologists of Australasia Quality Assurance Programs, Chemical Pathology, Endocrine Program...
July 18, 2017: Clinical Biochemistry
https://www.readbyqxmd.com/read/28731506/an-australian-mohs-external-quality-assurance-program
#3
Martyn Peck, Eleni Yiasemides, Tony Badrick
No abstract text is available yet for this article.
July 21, 2017: Australasian Journal of Dermatology
https://www.readbyqxmd.com/read/28730740/statistical-process-control-and-verifying-positional-accuracy-of-a-cobra-motion-couch-using-step-wedge-quality-assurance-tool
#4
Diana Binny, Craig M Lancaster, Jamie V Trapp, Scott B Crowe
This study utilizes process control techniques to identify action limits for TomoTherapy couch positioning quality assurance tests. A test was introduced to monitor accuracy of the applied couch offset detection in the TomoTherapy Hi-Art treatment system using the TQA "Step-Wedge Helical" module and MVCT detector. Individual X-charts, process capability (cp), probability (P), and acceptability (cpk) indices were used to monitor a 4-year couch IEC offset data to detect systematic and random errors in the couch positional accuracy for different action levels...
July 21, 2017: Journal of Applied Clinical Medical Physics
https://www.readbyqxmd.com/read/28729781/advanced-hysteroscopic-surgery-quality-assurance-in-teaching-hospitals
#5
REVIEW
Mark M S Erian, Glenda R McLaren, Anna-Marie Erian
Advanced hysteroscopic surgery (AHS) is a vitally important technique in the armamentarium for the management of many day-to-day clinical problems, such as menorrhagia, surgical excision of uterine myomata and septa in the management of female infertility, hysteroscopic excision of chronically retained products of conception (placenta accreta), and surgical removal of intramural ectopic pregnancy. In today's climate of accountability, it is necessary that gynecologists take a more active role in assuring the quality of their work...
April 2017: JSLS: Journal of the Society of Laparoendoscopic Surgeons
https://www.readbyqxmd.com/read/28727787/feasibility-of-a-3d-printed-anthropomorphic-patient-specific-head-phantom-for-patient-specific-quality-assurance-of-intensity-modulated-radiotherapy
#6
Ji Woon Yea, Jae Won Park, Sung Kyu Kim, Dong Youn Kim, Jae Gu Kim, Chan Young Seo, Won Hyo Jeong, Man Youl Jeong, Se An Oh
This study evaluated the feasibility of utilizing a 3D-printed anthropomorphic patient-specific head phantom for patient-specific quality assurance (QA) in intensity-modulated radiotherapy (IMRT). Contoured left and right head phantoms were converted from DICOM to STL format. Fused deposition modeling (FDM) was used to construct an anthropomorphic patient-specific head phantom with a 3D printer. An established QA technique and the patient-specific head phantom were used to compare the calculated and measured doses...
2017: PloS One
https://www.readbyqxmd.com/read/28726804/diagnostic-cytogenetic-testing-following-positive-noninvasive-prenatal-screening-results-a-clinical-laboratory-practice-resource-of-the-american-college-of-medical-genetics-and-genomics-acmg
#7
Athena M Cherry, Yassmine M Akkari, Kimberly M Barr, Hutton M Kearney, Nancy C Rose, Sarah T South, James H Tepperberg, Jeanne M Meck
Disclaimer: ACMG Clinical Laboratory Practice Resources are developed primarily as an educational tool for clinical laboratory geneticists to help them provide quality clinical laboratory genetic services. Adherence to these practice resources is voluntary and does not necessarily assure a successful medical outcome. This Clinical Laboratory Practice Resource should not be considered inclusive of all proper procedures and tests or exclusive of other procedures and tests that are reasonably directed to obtaining the same results...
July 20, 2017: Genetics in Medicine: Official Journal of the American College of Medical Genetics
https://www.readbyqxmd.com/read/28725254/interacts-interventional-radiotherapy-active-teaching-school-guidelines-for-quality-assurance-in-choroidal-melanoma-interventional-radiotherapy-brachytherapy-procedures
#8
REVIEW
Luca Tagliaferri, Monica Maria Pagliara, Luca Boldrini, Carmela Grazia Caputo, Luigi Azario, Maura Campitelli, Maria Antonietta Gambacorta, Daniela Smaniotto, Vincenzo Frascino, Francesco Deodato, Alessio Giuseppe Morganti, György Kovács, Vincenzo Valentini, Maria Antonietta Blasi
Eye plaque brachytherapy represents a safe and effective therapeutic approach for choroidal melanoma, combining clinical outcomes with an eye and visual preservation. As it represents a complex procedure, a specific quality assurance program is strongly suggested to improve patients and operators safety, and to reduce possible complications linked to surgical procedure and radiation exposure. The aim of this paper is to describe the INTERACTS (Interventional Radiotherapy Active Teaching School) guidelines for quality assurance in choroidal melanoma interventional radiotherapy (brachytherapy) used in our institution...
June 2017: Journal of Contemporary Brachytherapy
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#9
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28723767/return-of-the-cadaver-key-role-of-anatomic-dissection-for-plastic-surgery-resident-training
#10
Swenn Maxence Krähenbühl, Paul Čvančara, Thomas Stieglitz, Raphaël Bonvin, Murielle Michetti, Marjorie Flahaut, Sébastien Durand, Lina Deghayli, Lee Ann Applegate, Wassim Raffoul
Successful Plastic Surgery Residency training is subjected to evolving society pressure of lower hourly work weeks imposed by external committees, labor laws, and increased public awareness of patient care quality. Although innovative measures for simulation training of surgery are appearing, there is also the realization that basic anatomy training should be re-enforced and cadaver dissection is of utmost importance for surgical techniques.In the development of new technology for implantable neurostimulatory electrodes for the management of phantom limb pain in amputee patients, a design of a cadaveric model has been developed with detailed steps for innovative transfascicular insertion of electrodes...
July 2017: Medicine (Baltimore)
https://www.readbyqxmd.com/read/28723580/quality-assurance-of-chemical-ingredient-classification-for-the-national-drug-file-reference-terminology
#11
Ling Zheng, Hasan Yumak, Ling Chen, Christopher Ochs, James Geller, Joan Kapusnik-Uner, Yehoshua Perl
The National Drug File - Reference Terminology (NDF-RT) is a large and complex drug terminology consisting of several classification hierarchies on top of an extensive collection of drug concepts. These hierarchies provide important information about clinical drugs, e.g., their chemical ingredients, mechanisms of action, dosage form and physiological effects. Within NDF-RT such information is represented using tens of thousands of roles connecting drugs to classifications. In previous studies, we have introduced various kinds of Abstraction Networks to summarize the content and structure of terminologies in order to facilitate their visual comprehension, and support quality assurance of terminologies...
July 16, 2017: Journal of Biomedical Informatics
https://www.readbyqxmd.com/read/28723228/thermal-processing-of-live-bivalve-molluscs-for-controlling-viruses-on-the-need-for-a-risk-based-design
#12
Winy Messens, Pablo S Fernandez-Escamez, David Lees, Roland Lindqvist, Michael O'Mahony, Elisabetta Suffredini, José Cortiñas Abrahantes, Emmanouil Chantzis, Kostas Koutsoumanis
Norovirus (NoV) and Hepatitis A virus (HAV) are the most important viral hazards associated with human illness following consumption of contaminated bivalve molluscs. The effectiveness of the current EU criteria for heat processing of bivalve molluscs (i.e. raising the temperature of the internal mollusc flesh to at least 90°C for a minimum of 90 seconds) was evaluated using predictive microbiology. A HAV thermal inactivation model was developed based on literature data in mollusc matrices during isothermal heat treatment...
July 19, 2017: Critical Reviews in Food Science and Nutrition
https://www.readbyqxmd.com/read/28722774/-promoting-continuity-of-care-specialist-nurses-role-experiences-in-gynaecological-oncology-a-qualitative-study
#13
Andrea Kobleder, Hanna Mayer, Larissa Gehrig, Beate Senn
AIMS AND OBJECTIVES: To investigate the experiences of specialist nurses in Switzerland concerning their role of caring for women with gynaecological cancer. BACKGROUND: Women with gynaecological cancer often face complex situations, which require an integrative and quality-assured approach by the healthcare system. Specialist nurses can play an important role in supporting these patients. However, in countries where the role of specialist nurses is at a developmental stage, their role lacks clarity...
July 19, 2017: Journal of Clinical Nursing
https://www.readbyqxmd.com/read/28722310/capitalizing-on-scientific-advances-to-improve-access-to-and-quality-of-children-s-mental-health-care
#14
Ann F Garland, Florencia Lebensohn-Chialvo, Kristopher G Hall, Erika R N Cameron
The majority of mental health problems begin in childhood or adolescence. The potential benefits of early identification and treatment of such problems are well established, and models of effective mental health interventions for children have proliferated in recent decades. However, barriers in access to care and challenges in assuring delivery of high-quality care significantly limit the public health impact of services for children and families. Specifically, the majority of children who need mental health care do not receive it, and when children are in care, many do not receive interventions that are most likely to have the greatest positive impact...
July 19, 2017: Behavioral Sciences & the Law
https://www.readbyqxmd.com/read/28720680/quality-materials-for-quality-assurance-in-the-analysis-of-liquid-biopsy-samples
#15
EDITORIAL
Jason C H Tsang, K C Allen Chan
No abstract text is available yet for this article.
July 18, 2017: Clinical Chemistry
https://www.readbyqxmd.com/read/28720627/costs-of-transforming-established-primary-care-practices-to-patient-centered-medical-homes-pcmhs
#16
Neil S Fleming, Briget da Graca, Gerald O Ogola, Steven D Culler, Jessica Austin, Patrice McConnell, Russell McCorkle, Phil Aponte, Michael Massey, Cliff Fullerton
BACKGROUND: The patient-centered medical home (PCMH) shows promise for improving care and reducing costs. We sought to reduce the uncertainty regarding the time and cost of PCMH transformation by quantifying the direct costs of transforming 57 practices in a medical group to National Committee for Quality Assurance (NCQA)-recognized Level III PCMHs. METHODS: We conducted structured interviews with corporate leaders, and with physicians, practice administrators, and office managers from a representative sample of practices regarding time spent on PCMH transformation and NCQA application, and related purchases...
July 2017: Journal of the American Board of Family Medicine: JABFM
https://www.readbyqxmd.com/read/28717901/performance-assessment-of-a-programmable-five-degrees-of-freedom-motion-platform-for-quality-assurance-of-motion-management-techniques-in-radiotherapy
#17
Chen-Yu Huang, Paul Keall, Adam Rice, Emma Colvill, Jin Aun Ng, Jeremy T Booth
Inter-fraction and intra-fraction motion management methods are increasingly applied clinically and require the development of advanced motion platforms to facilitate testing and quality assurance program development. The aim of this study was to assess the performance of a 5 degrees-of-freedom (DoF) programmable motion platform HexaMotion (ScandiDos, Uppsala, Sweden) towards clinically observed tumor motion range, velocity, acceleration and the accuracy requirements of SABR prescribed in AAPM Task Group 142...
July 17, 2017: Australasian Physical & Engineering Sciences in Medicine
https://www.readbyqxmd.com/read/28715745/a-practical-protocol-for-comprehensive-evaluation-of-sulfur-fumigation-of-gastrodia-rhizoma-using-metabolome-and-health-risk-assessment-analysis
#18
Chuanzhi Kang, Chang-Jiang-Sheng Lai, Dan Zhao, Tao Zhou, Da-Hui Liu, Chaogeng Lv, Sheng Wang, Liping Kang, Jian Yang, Zhi-Lai Zhan, Lu-Qi Huang, Lanping Guo
Gastrodia Rhizoma is one of the most heavily sulfur-fumigated edible and medical herbs in the marketplace. We developed a practical protocol using an ultra-performance liquid chromatography coupled with quadrupole time-of-flight-MS(E) (UPLC/QTOF-MS(E))-based metabolome and health risk assessment model to identify characteristic sulfur-fumigated markers, dissect chemical transformation mechanisms, and control the quality of sulfur-fumigated Gastrodia Rhizoma. Two sulfur-containing p-hydroxybenzyl products, one sulfur-containing disaccharide, one glycolipid, and two phospholipids were selected and identified as markers based on multivariate statistical analysis...
July 4, 2017: Journal of Hazardous Materials
https://www.readbyqxmd.com/read/28715491/towards-the-development-of-a-comprehensive-framework-qualitative-systematic-survey-of-definitions-of-clinical-research-quality
#19
Belinda von Niederhäusern, Stefan Schandelmaier, Marie Mi Bonde, Nicole Brunner, Lars G Hemkens, Marielle Rutquist, Neera Bhatnagar, Gordon H Guyatt, Christiane Pauli-Magnus, Matthias Briel
OBJECTIVE: To systematically survey existing definitions, concepts, and criteria of clinical research quality, both developed by stakeholder groups as well as in the medical literature. This study serves as a first step in the development of a comprehensive framework for the quality of clinical research. STUDY DESIGN AND SETTING: We systematically and in duplicate searched definitions, concepts and criteria of clinical research quality on websites of stakeholders in clinical research until no further insights emerged and in MEDLINE up to February 2015...
2017: PloS One
https://www.readbyqxmd.com/read/28715361/trauma-systems-around-the-world-a-systematic-overview
#20
Suzan Dijkink, Charlie Nederpelt, Pieta Krijnen, George C Velmahos, Inger B Schipper
BACKGROUND: Implementation of trauma care systems has resulted in improved patient outcomes, but international differences obviously remain. Improvement of care can only be established if we recognize and clarify these differences. The aim of the current review is to provide an overview of the recent literature on the state of trauma systems globally. METHODS: The literature review over the period 2000-2016 was conducted following the PRISMA guidelines. Pre-hospital care, acute hospital care and quality assurance were classified using the WHO Trauma System Maturity Index in four levels from I (least mature) to IV (most mature)...
July 15, 2017: Journal of Trauma and Acute Care Surgery
keyword
keyword
1587
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"