keyword
MENU ▼
Read by QxMD icon Read
search

Botanical medicine

keyword
https://www.readbyqxmd.com/read/28729836/an-overview-of-herbal-products-and-secondary-metabolites-used-for-management-of-type-two-diabetes
#1
REVIEW
Ajda Ota, Nataša P Ulrih
Diabetes mellitus is a common effect of uncontrolled high blood sugar and it is associated with long-term damage, dysfunction, and failure of various organs. In the adult population, the global prevalence of diabetes has nearly doubled since 1980. Without effective prevention and management programs, the continuing significant rise in diabetes will have grave consequences on the health and lifespan of the world population, and also on the world economy. Supplements can be used to correct nutritional deficiencies or to maintain an adequate intake of certain nutrients...
2017: Frontiers in Pharmacology
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#2
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28683559/botanical-sources-for-alzheimer-s-a-review-on-reports-from-traditional-persian-medicine
#3
Ayda Hosseinkhani, Ali Sahragard, Aida Namdari, Mohammad M Zarshenas
Herbal medicines for the treatment of Alzheimer's disease (AD) have attracted considerable attention nowadays. Alzheimer's disease is described in traditional Persian medicine (TPM) by the term Nesyān. In this study, 5 main medicinal medieval Persian manuscripts were reviewed to filter plants reported for the treatment of Nesyān. Databases were searched for related possible mechanisms of action of these medicinal plants. Each herb was searched for along with these keywords: "acetyl and butyryl cholinesterase inhibition," "antioxidant," "anti-inflammatory," and "anti-amyloidogenic...
January 1, 2017: American Journal of Alzheimer's Disease and Other Dementias
https://www.readbyqxmd.com/read/28658390/foliar-phenolic-compounds-of-ten-wild-species-of-verbenacea-as-antioxidants-and-specific-chemomarkers
#4
J A Ávila-Reyes, N Almaraz-Abarca, A I Chaidez-Ayala, D Ramírez-Noya, E A Delgado-Alvarado, R Torres-Ricario, N Naranjo-Jiménez, R E Alanís-Bañuelos
The family Verbenaceae hosts important species used in traditional medicine of many countries. The taxonomic controversies concerning the specific delimitation of several of its species make it difficult to guarantee the botanical origin of herbal preparations based on species of this family. To contribute to the development of both specific chemomarkers and a quality control tool to authenticate the botanical origin of herbal preparations of Verbenacea species, we determined the foliar HPLC-DAD phenolic profiles and the antioxidant properties of 10 wild species of this family occurring in Mexico...
June 26, 2017: Brazilian Journal of Biology, Revista Brasleira de Biologia
https://www.readbyqxmd.com/read/28657934/multitarget-botanical-pharmacotherapy-in-major-depression-a-toxic-brain-hypothesis
#5
Siu W Tang, Wayne H Tang, Brain E Leonard
A significant number of patients with major depression do not respond optimally to current antidepressant drugs. As depression is likely to be a heterogeneous disorder, it is possible that existing neurotransmitter-based antidepressant drugs do not fully address other pathologies that may exist in certain cases. Biological pathologies related to depression that have been proposed and studied extensively include inflammation and immunology, hypercortisolemia, oxidative stress, and impaired angiogenesis. Such pathologies may induce neurodegeneration, which in turn causes cognitive impairment, a symptom increasingly being recognized in depression...
June 27, 2017: International Clinical Psychopharmacology
https://www.readbyqxmd.com/read/28648928/pg2-a-botanically-derived-drug-extracted-from-astragalus-membranaceus-promotes-proliferation-and-immunosuppression-of-umbilical-cord-derived-mesenchymal-stem-cells
#6
Yu-Hua Chao, Kang-Hsi Wu, Chiao-Wen Lin, Shun-Fa Yang, Wan-Ru Chao, Ching-Tien Peng, Han-Ping Wu
ETHNOPHARMACOLOGICAL RELEVANCE: Astragalus membranaceus is used to manage the deficiency of vital energy in traditional Chinese medicine and confirmed to have many biological functions. Mesenchymal stem cells (MSCs) possess immunosuppressive effects, and are widely used for regenerative medicine and immune disorders. AIMS OF STUDY: This study investigated the effects of Astragalus polysaccharides (APS) on umbilical cord-derived MSCs (UCMSCs), including morphology, surface marker expression, proliferation, differentiation, and in-vitro and in-vivo immunosuppressive capacities...
June 23, 2017: Journal of Ethnopharmacology
https://www.readbyqxmd.com/read/28646815/integrative-treatment-of-chronic-abdominal-bloating-and-pain-associated-with-overgrowth-of-small-intestinal-bacteria-a-case-report
#7
Laura Kwiatkowski, Elizabeth Rice, Jeffrey Langland
Context • Small intestinal bacterial overgrowth (SIBO) is commonly defined as an increased number of bacteria and/or an abnormal type of bacteria in the small intestine. Conventional treatment for SIBO is typically focused on antibiotics to eradicate the bacterial overgrowth. Numerous studies have demonstrated the antimicrobial activity of herbs, and a diet low in fermentable oligo-, di-, and monosaccharides and polyols (FODMAPs) has been shown to enhance antibiotic therapy. Objective • The current case study intended to evaluate the benefits of an alternative, multifaceted approach-including botanical and homeopathic therapies in conjunction with a low-FODMAP diet-in the treatment of SIBO and its associated symptoms...
July 2017: Alternative Therapies in Health and Medicine
https://www.readbyqxmd.com/read/28639115/chemical-composition-of-selected-commercial-herbal-remedies-in-relation-to-geographical-origin-and-inter-species-diversity
#8
Pawel Konieczynski, Agnieszka Viapiana, Roman Lysiuk, Marek Wesolowski
Infusions prepared from medicinal herbs that are rich in flavonoids are very popular herbal remedies in societies of Eastern Europe. Therefore, the content of essential elements together with total flavonoids was analyzed in 65 commercially available samples of herbal drugs originating from Ukraine, Romania, and Belarus. The results showed that metallic elements (in mg kg(-1) d.w.) have occurred in the following order: Fe > Mn > Zn > Cu, both for total and water-extractable species. Total flavonoids were determined in the range from 10...
June 21, 2017: Biological Trace Element Research
https://www.readbyqxmd.com/read/28636884/major-achievements-of-evidence-based-traditional-chinese-medicine-in-treating-major-diseases
#9
REVIEW
Jung Chao, Yuntao Dai, Robert Verpoorte, Wing Lam, Yung-Chi Cheng, Li-Heng Pao, Wei Zhang, Shilin Chen
A long history of use and extensive documentation of the clinical practices of traditional Chinese medicine resulted in a considerable number of classical preparations, which are still widely used. This heritage of our ancestors provides a unique resource for drug discovery. Already, a number of important drugs have been developed from traditional medicines, which in fact form the core of Western pharmacotherapy. Therefore, this article discusses the differences in drug development between traditional medicine and Western medicine...
June 18, 2017: Biochemical Pharmacology
https://www.readbyqxmd.com/read/28634392/the-traditional-chinese-medicine-achyranthes-bidentata-and-our-de-novo-conception-of-its-metastatic-chemoprevention-from-phytochemistry-to-pharmacology
#10
Zhou Jiang, Jun Qian, Haiyan Dong, Jingyi Yang, Xiaobo Yu, Jianzhong Chen, Hongning Chen, Qing Shi, Lee Jia
Our recent biosystems analysis revealed similarities between embryonic implantation and cancer cell adhesion, which suggests that abortifacients may be good for safe and effective metastatic chemoprevention targeting circulating tumor cells (CTC). Here we test the hypothesis by using the well-known abortion herb Achyranthes bidentata Blume (A. bidentata). Five compounds were separated from the herb root. Among them, ginsenoside Ro was the most potent in inhibiting embryonic implantation within non-cytotoxic concentrations...
June 20, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28631817/application-of-high-resolution-melting-analysis-for-authenticity-testing-of-valuable-dendrobium-commercial-products
#11
Xiaoman Dong, Chao Jiang, Yuan Yuan, Daiyin Peng, Yuqin Luo, Yuyang Zhao, Luqi Huang
BACKGROUND: The accurate identification of botanical origin in commercial products is important to ensure food authenticity and safety for consumers. The Dendrobium species have long been commercialized as functional food supplements and herbal medicines in Asia. Three valuable Dendrobium species, namely Dendrobium officinale, D. huoshanense and D. moniliforme, are often mutually adulterated in trade products in pursuit of higher profit. RESULTS: In this paper, a rapid and reliable semi-quantitative method for identifying the botanical origin of Dendrobium products in terminal markets was developed using HRM (High-Resolution Melting) analysis with specific primer pairs to target the trnL-F region...
June 20, 2017: Journal of the Science of Food and Agriculture
https://www.readbyqxmd.com/read/28629185/leptadenia-reticulata-retz-wight-arn-jivanti-botanical-agronomical-phytochemical-pharmacological-and-biotechnological-aspects
#12
REVIEW
Sudipta Kumar Mohanty, Mallappa Kumara Swamy, Uma Rani Sinniah, Maniyam Anuradha
Leptadenia reticulata (Retz.) Wight & Arn. (Apocynaceae), is a traditional medicinal plant species widely used to treat various ailments such as tuberculosis, hematopoiesis, emaciation, cough, dyspnea, fever, burning sensation, night blindness, cancer, and dysentery. In Ayurveda, it is known for its revitalizing, rejuvenating, and lactogenic properties. This plant is one of the major ingredients in many commercial herbal formulations, including Speman, Envirocare, Calshakti, Antisept, and Chyawanprash. The therapeutic potential of this herb is because of the presence of diverse bioactive compounds such as α-amyrin, β-amyrin, ferulic acid, luteolin, diosmetin, rutin, β-sitosterol, stigmasterol, hentricontanol, a triterpene alcohol simiarenol, apigenin, reticulin, deniculatin, and leptaculatin...
June 19, 2017: Molecules: a Journal of Synthetic Chemistry and Natural Product Chemistry
https://www.readbyqxmd.com/read/28626426/potential-of-central-eastern-and-western-africa-medicinal-plants-for-cancer-therapy-spotlight-on-resistant-cells-and-molecular-targets
#13
REVIEW
Armelle T Mbaveng, Victor Kuete, Thomas Efferth
Cancer remains a major health hurdle worldwide and has moved from the third leading cause of death in the year 1990 to second place after cardiovascular disease since 2013. Chemotherapy is one of the most widely used treatment modes; however, its efficiency is limited due to the resistance of cancer cells to cytotoxic agents. The present overview deals with the potential of the flora of Central, Eastern and Western African (CEWA) regions as resource for anticancer drug discovery. It also reviews the molecular targets of phytochemicals of these plants such as ABC transporters, namely P-glycoprotein (P-gp), multi drug-resistance-related proteins (MRPs), breast cancer resistance protein (BCRP, ABCG2) as well as the epidermal growth factor receptor (EGFR/ErbB-1/HER1), human tumor suppressor protein p53, caspases, mitochondria, angiogenesis, and components of MAP kinase signaling pathways...
2017: Frontiers in Pharmacology
https://www.readbyqxmd.com/read/28618131/pharmacognosy-phytochemistry-and-pharmacological-properties-of-achillea-millefolium-l-a-review
#14
REVIEW
Sofi Imtiyaz Ali, B Gopalakrishnan, V Venkatesalu
Achillea millefoilum L. (Yarrow) is an important species of Asteraceae family with common utilization in traditional medicine of several cultures from Europe to Asia for the treatment of spasmodic gastrointestinal disorders, hepatobiliary, gynecological disorders, against inflammation and for wound healing. An extensive review of literature was made on A. millefoilum L. using ethno botanical text books, published articles in peer-reviewed journals, unpublished materials and scientific databases. The Plant List, International Plant Name Index and Kew Botanical Garden databases were used to authenticate the scientific names...
June 15, 2017: Phytotherapy Research: PTR
https://www.readbyqxmd.com/read/28605829/application-of-metabolomics-to-quality-control-of-natural-product-derived-medicines
#15
REVIEW
Kyung-Min Lee, Jun-Yeong Jeon, Byeong-Ju Lee, Hwanhui Lee, Hyung-Kyoon Choi
Metabolomics has been used as a powerful tool for the analysis and quality assessment of the natural product (NP)-derived medicines. It is increasingly being used in the quality control and standardization of NP-derived medicines because they are composed of hundreds of natural compounds. The most common techniques that are used in metabolomics consist of NMR, GC-MS, and LC-MS in combination with multivariate statistical analyses including principal components analysis (PCA) and partial least squares-discriminant analysis (PLS-DA)...
June 14, 2017: Biomolecules & Therapeutics
https://www.readbyqxmd.com/read/28603575/antimicrobial-fungal-endophytes-from-the-botanical-medicine-goldenseal-hydrastis-canadensis
#16
Joseph M Egan, Amninder Kaur, Huzefa A Raja, Joshua J Kellogg, Nicholas H Oberlies, Nadja B Cech
The potential of fungal endophytes to alter or contribute to plant chemistry and biology has been the topic of a great deal of recent interest. For plants that are used medicinally, it has been proposed that endophytes might play an important role in biological activity. With this study, we sought to identify antimicrobial fungal endophytes from the medicinal plant goldenseal (Hydrastis canadensis L., Ranunculaceae), a plant used in traditional medicine to treat infection. A total of 23 fungal cultures were obtained from surface-sterilized samples of H...
September 2016: Phytochemistry Letters
https://www.readbyqxmd.com/read/28595500/the-genus-patrinia-a-review-of-traditional-uses-phytochemical-and-pharmacological-studies
#17
Xirui He, Fei Luan, Zefeng Zhao, Ning Ning, Maoxing Li, Ling Jin, Yu Chang, Qiang Zhang, Ni Wu, Linhong Huang
The aim of the present review is to comprehensively outline the botanical description, traditional uses, phytochemistry, pharmacology and toxicology of Patrinia, and to discuss possible trends for the further study of medicinal plants from the genus Patrinia. The genus Patrinia plays an important role in Asian medicine for the treatment of erysipelas, conjunctival congestion with swelling and pain, peri-appendicular abscesses, lung carbuncle, dysentery, leucorrhea, and postpartum disease. More than 210 chemical constituents have been isolated and identified from Patrinia plants, especially P...
2017: American Journal of Chinese Medicine
https://www.readbyqxmd.com/read/28592581/the-stop-ab-trial-protocol-efficacy-and-safety-of-discontinuing-patient-antibiotic-treatment-when-physicians-no-longer-consider-it-necessary
#18
Carl Llor, Ana Moragas, Carolina Bayona, Josep M Cots, José M Molero, Joana Ribas, Julio Francisco Fóthy, Isabel Gutiérrez, Coro Sánchez, Jesús Ortega, Javier Arranz, Jenifer Botanes, Purificación Robles
INTRODUCTION: Since 2011, the Spanish Society of Family Medicine has recommended general practitioners (GPs) to ask their patients to stop taking antibiotics when they suspect a viral infection. However, this practice is seldom used because uncertainty about diagnosis, and fear of consequences of discontinuing antibiotic therapy, as well as perceived pressure to continue prescribing antibiotics and potential conflict with patients are more of a concern for GPs than antibiotic resistance...
June 6, 2017: BMJ Open
https://www.readbyqxmd.com/read/28569293/rhubarb-rheum-species-the-role-of-edinburgh-in-its-cultivation-and-development
#19
M R Lee, J Hutcheon, E Dukan, I Milne
Rhubarb was grown and used throughout China for thousands of years. It then found its way to St Petersburg where the Romanovs developed a flourishing trade in the plant to the rest of Europe. James Mounsey, a physician to the Tsar, brought back seeds from Russia to Scotland at considerable risk to himself. He passed some of the seeds to Alexander Dick and John Hope. Both these physicians then grew rhubarb at Prestonfield and the Botanic Garden (both in Edinburgh), respectively. Eventually rhubarb, in the form of Gregory's powder, became a common and popular medicine throughout the UK...
March 2017: Journal of the Royal College of Physicians of Edinburgh
https://www.readbyqxmd.com/read/28559960/medicinal-plants-for-the-treatment-of-obesity-ethnopharmacological-approach-and-chemical-and-biological-studies
#20
REVIEW
Luciano Mamede de Freitas Junior, Eduardo B de Almeida
Obesity is a global epidemic that has shown a steady increase in morbimortality indicators; it is considered a social problem and entails serious health risks. One of the alternatives in the treatment of obesity is the traditional use of medicinal plants, which supports the research and development of obesity phytotherapy. In this article, we provide information about ethnopharmacological species used to treat obesity, through an electronic search of the periodical databases Web of Science, Scopus, PubMed and Scielo, considering the period 1996-2015 and using the descriptors "plants for obesity", "ethnopharmacology for obesity" and "anti-obesity plants" in both Portuguese and English...
2017: American Journal of Translational Research
keyword
keyword
121120
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"