keyword
MENU ▼
Read by QxMD icon Read
search

Botanical medicine

keyword
https://www.readbyqxmd.com/read/28807848/hydroalcoholic-extract-from-bark-of-persea-major-meisn-l-e-kopp-lauraceae-exerts-antiulcer-effects-in-rodents-by-the-strengthening-of-the-gastric-protective-factors
#1
Lincon Bordignon Somensi, Thaise Boeing, Benhur Judah Cury, Viviane Miranda Bispo Steimbach, Rivaldo Niero, Lauro Mera de Souza, Luisa Mota da Silva, Sérgio Faloni de Andrade
ETHOPHARMACOLOGICAL RELEVANCE: The Persea major (Meisn.) L.E. Kopp (Lauraceae) (botanical synonym: Persea pyrifolia (D. Don) Spreng, Persea pyrifolia Nees and Mart., Persea cordata var. major (Meisn.) Mez and Persea willdenovii Kosterm) is a medicinal plant native in the south of Brazil, where is popularly known as Pau de Andrade, Maçaranduba or Abacate-do-Mato. Its barks are commonly used to prepare an infusion which is administered orally or topically to treat ulcers and wounds, respectively...
August 11, 2017: Journal of Ethnopharmacology
https://www.readbyqxmd.com/read/28793900/botanical-ethnoveterinary-therapies-used-by-agro-pastoralists-of-fafan-zone-eastern-ethiopia
#2
Teka Feyera, Endalkachew Mekonnen, Befekadu Urga Wakayo, Solomon Assefa
BACKGROUND: In Ethiopia, plant based remedies are still the most important and sometimes the only source of therapeutics in the management of livestock diseases. However, documentation of this indigenous knowledge of therapeutic system still remains at a minimum level. The aim of this study was, thus, to document the traditional knowledge of botanical ethnoveterinary therapies in the agro-pastoral communities of Fafan Zone, Eastern Ethiopia. METHODS: The study employed a cross-sectional participatory survey...
August 9, 2017: BMC Veterinary Research
https://www.readbyqxmd.com/read/28792522/biochemical-characterization-and-anti-inflammatory-properties-of-an-isothiocyanate-enriched-moringa-moringa-oleifera-seed-extract
#3
Asha Jaja-Chimedza, Brittany L Graf, Charlotte Simmler, Youjin Kim, Peter Kuhn, Guido F Pauli, Ilya Raskin
Moringa oleifera Lam. is a tropical plant, used for centuries as food and traditional medicine. The aim of this study was to develop, validate and biochemically characterize an isothiocyanate-enriched moringa seed extract (MSE), and to compare the anti-inflammatory effects of MSE-containing moringa isothiocyanate-1 (MIC-1) with a curcuminoid-enriched turmeric extract (CTE), and a material further enriched in its primary phytochemical, curcumin (curcumin-enriched material; CEM). MSE was prepared by incubating ground moringa seeds with water to allow myrosinase-catalyzed enzymatic formation of bioactive MIC-1, the predominant isothiocyanate in moringa seeds...
2017: PloS One
https://www.readbyqxmd.com/read/28789798/development-of-a-validated-ultra-high-performance-liquid-chromatography-tandem-mass-spectrometry-method-for-determination-of-acid-diterpenes-in-copaifera-oleoresins
#4
Jonas Joaquim Mangabeira da Silva, Eduardo José Crevelin, Luiza Junqueira Carneiro, Hervé Rogez, Rodrigo Cassio Sola Veneziani, Sérgio Ricardo Ambrósio, Luiz Alberto Beraldo Moraes, Jairo Kenupp Bastos
Species of Copaifera genus (Fabaceae - Caesalpinoiodidaeae) produces an important commercial oleoresin that displays many medicinal properties. Copaifera oleoresins (COR) are composed mainly of a mixture of diterpenes and sequiterpenes, and the main reported acid diterpenes for this genus are kaurenoic, copalic, hardwickiic and polyaltic acids. An ultra-performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) method was developed and validated for identification and quantification of nine acid diterpenes...
July 12, 2017: Journal of Chromatography. A
https://www.readbyqxmd.com/read/28771010/systems-pharmacology-dissection-of-multi-scale-mechanisms-of-action-for-herbal-medicines-in-treating-rheumatoid-arthritis
#5
Jinghui Wang, Yan Li, Yinfeng Yang, Jian Du, Miaoqing Zhao, Feng Lin, Shuwei Zhang, Bin Wang
As a chronic inflammatory and angiogenic disease with increased morbidity and mortality, rheumatoid arthritis (RA) is characterized by the proliferation of synovial tissue and the accumulation of excessive mononuclear infiltration, which always results in the joint deformity, disability, and eventually the destruction of the bone and cartilage. Traditional Chinese Medicine (TCM), with rich history of proper effectiveness in treating the inflammatory joint disease containing RA, has long combated such illness from, actually, an integrative and holistic point of view...
August 3, 2017: Molecular Pharmaceutics
https://www.readbyqxmd.com/read/28769789/knowledge-of-medicinal-plants-for-children-diseases-in-the-environs-of-district-bannu-khyber-pakhtoonkhwa-kpk
#6
Shabnam Shaheen, Safdar Abbas, Javid Hussain, Fazal Mabood, Muhammad Umair, Maroof Ali, Mushtaq Ahmad, Muhammad Zafar, Umar Farooq, Ajmal Khan
Medicinal plants are important treasures for the treatment of different types of diseases. Current study provides significant ethnopharmacological information, both qualitative and quantitative on medical plants related to children disorders from district Bannu, Khyber Pakhtunkhwa (KPK) province of Pakistan. The information gathered was quantitatively analyzed using informant consensus factor, relative frequency of citation and use value method to establish a baseline data for more comprehensive investigations of bioactive compounds of indigenous medicinal plants specifically related to children disorders...
2017: Frontiers in Pharmacology
https://www.readbyqxmd.com/read/28764723/systematic-review-on-traditional-medicinal-plants-used-for-the-treatment-of-malaria-in-ethiopia-trends-and-perspectives
#7
REVIEW
Getachew Alebie, Befikadu Urga, Amha Worku
BACKGROUND: Ethiopia is endowed with abundant medicinal plant resources and traditional medicinal practices. However, available research evidence on indigenous anti-malarial plants is highly fragmented in the country. The present systematic review attempted to explore, synthesize and compile ethno-medicinal research evidence on anti-malarial medicinal plants in Ethiopia. METHODS: A systematic web search analysis and review was conducted on research literature pertaining to medicinal plants used for traditional malaria treatment in Ethiopia...
August 1, 2017: Malaria Journal
https://www.readbyqxmd.com/read/28762666/developmental-toxicity-evaluation-of-pimenta-pseudocaryophyllus-gomes-landrum-e-methyl-isoeugenol-chemotype-in-wistar-rats
#8
Bruce Soares Cardoso, Katia Borges Machado, José Realino de Paula, Joelma Abadia Marciano de Paula, Wilson de Melo Cuvinel, Vanessa Cristiane Santana Amaral
BACKGROUND: Pimenta pseudocaryophyllus (Gomes) Landrum (Myrtaceae) has been traditionally used in Brazilian folk medicine. Studies have established the botanical characterization, phytochemistry profile, and pharmacological potential of this species, including antibiotic, anxiolytic, antidepressant, antioxidant, antinociceptive, and anti-inflammatory properties. Despite its widespread use, no previous study has been conducted regarding its toxicological profile, especially during pregnancy...
August 1, 2017: Birth defects research
https://www.readbyqxmd.com/read/28755969/plant-based-remedies-for-wolf-bites-and-rituals-against-wolves-in-the-iberian-peninsula-therapeutic-opportunities-and-cultural-values-for-the-conservation-of-biocultural-diversity
#9
REVIEW
José A González, Ana Maria Carvalho, José Ramón Vallejo, Francisco Amich
ETHNOPHARMACOLOGICAL RELEVANCE: Combined approaches to local knowledge and folk plant use improve awareness and promote effective strategies for the conservation of significant biocultural patrimony. Moreover, the information reported might be the basis for further appropriate phytochemical and pharmacological research. Therefore we provide an insight into traditional herbal remedies and practices for healing bite injuries in humans and domestic animals caused by the Iberian wolf. Wolf bites are associated with inflammatory processes and rabies is a potential complication AIMS: This paper describes and summarises the medicinal-veterinary empirical and ritual uses of the Iberian flora for wolf injuries and reviews the ethnopharmacological data of specific plants that are already published...
July 27, 2017: Journal of Ethnopharmacology
https://www.readbyqxmd.com/read/28736584/secondary-metabolites-from-the-leaves-of-the-medicinal-plant-goldenseal-hydrastis-canadensis
#10
Martha Leyte-Lugo, Emily R Britton, Daniel H Foil, Adam R Brown, Daniel A Todd, José Rivera-Chávez, Nicholas H Oberlies, Nadja B Cech
The study presented herein constitutes an extensive investigation of constituents in Hydrastis canadensis L. (Ranunculaceae) leaves. It describes the isolation and identification of two previously unknown compounds, 3,4-dimethoxy-2-(methoxycarbonyl)benzoic acid (1) and 3,5,3'-trihydroxy-7,4'-dimethoxy-6,8-C-dimethyl-flavone (2), along with the known compounds (±)-chilenine (3), (2R)-5,4'-dihydroxy-6-C-methyl-7-methoxy-flavanone (4), 5,4'-dihydroxy-6,8-di-C-methyl-7-methoxy-flavanone (5), noroxyhydrastinine (6), oxyhydrastinine (7) and 4',5'-dimethoxy-4-methyl-3'-oxo-(1,2,5,6-tetrahydro-4H-1,3-dioxolo-[4',5':4,5]-benzo[1,2-e]-1,2-oxazocin)-2-spiro-1'-phtalan (8)...
June 2017: Phytochemistry Letters
https://www.readbyqxmd.com/read/28729836/an-overview-of-herbal-products-and-secondary-metabolites-used-for-management-of-type-two-diabetes
#11
REVIEW
Ajda Ota, Nataša P Ulrih
Diabetes mellitus is a common effect of uncontrolled high blood sugar and it is associated with long-term damage, dysfunction, and failure of various organs. In the adult population, the global prevalence of diabetes has nearly doubled since 1980. Without effective prevention and management programs, the continuing significant rise in diabetes will have grave consequences on the health and lifespan of the world population, and also on the world economy. Supplements can be used to correct nutritional deficiencies or to maintain an adequate intake of certain nutrients...
2017: Frontiers in Pharmacology
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#12
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28683559/botanical-sources-for-alzheimer-s-a-review-on-reports-from-traditional-persian-medicine
#13
Ayda Hosseinkhani, Ali Sahragard, Aida Namdari, Mohammad M Zarshenas
Herbal medicines for the treatment of Alzheimer's disease (AD) have attracted considerable attention nowadays. Alzheimer's disease is described in traditional Persian medicine (TPM) by the term Nesyān. In this study, 5 main medicinal medieval Persian manuscripts were reviewed to filter plants reported for the treatment of Nesyān. Databases were searched for related possible mechanisms of action of these medicinal plants. Each herb was searched for along with these keywords: "acetyl and butyryl cholinesterase inhibition," "antioxidant," "anti-inflammatory," and "anti-amyloidogenic...
January 1, 2017: American Journal of Alzheimer's Disease and Other Dementias
https://www.readbyqxmd.com/read/28658390/foliar-phenolic-compounds-of-ten-wild-species-of-verbenacea-as-antioxidants-and-specific-chemomarkers
#14
J A Ávila-Reyes, N Almaraz-Abarca, A I Chaidez-Ayala, D Ramírez-Noya, E A Delgado-Alvarado, R Torres-Ricario, N Naranjo-Jiménez, R E Alanís-Bañuelos
The family Verbenaceae hosts important species used in traditional medicine of many countries. The taxonomic controversies concerning the specific delimitation of several of its species make it difficult to guarantee the botanical origin of herbal preparations based on species of this family. To contribute to the development of both specific chemomarkers and a quality control tool to authenticate the botanical origin of herbal preparations of Verbenacea species, we determined the foliar HPLC-DAD phenolic profiles and the antioxidant properties of 10 wild species of this family occurring in Mexico...
June 26, 2017: Brazilian Journal of Biology, Revista Brasleira de Biologia
https://www.readbyqxmd.com/read/28657934/multitarget-botanical-pharmacotherapy-in-major-depression-a-toxic-brain-hypothesis
#15
Siu W Tang, Wayne H Tang, Brain E Leonard
A significant number of patients with major depression do not respond optimally to current antidepressant drugs. As depression is likely to be a heterogeneous disorder, it is possible that existing neurotransmitter-based antidepressant drugs do not fully address other pathologies that may exist in certain cases. Biological pathologies related to depression that have been proposed and studied extensively include inflammation and immunology, hypercortisolemia, oxidative stress, and impaired angiogenesis. Such pathologies may induce neurodegeneration, which in turn causes cognitive impairment, a symptom increasingly being recognized in depression...
June 27, 2017: International Clinical Psychopharmacology
https://www.readbyqxmd.com/read/28648928/pg2-a-botanically-derived-drug-extracted-from-astragalus-membranaceus-promotes-proliferation-and-immunosuppression-of-umbilical-cord-derived-mesenchymal-stem-cells
#16
Yu-Hua Chao, Kang-Hsi Wu, Chiao-Wen Lin, Shun-Fa Yang, Wan-Ru Chao, Ching-Tien Peng, Han-Ping Wu
ETHNOPHARMACOLOGICAL RELEVANCE: Astragalus membranaceus is used to manage the deficiency of vital energy in traditional Chinese medicine and confirmed to have many biological functions. Mesenchymal stem cells (MSCs) possess immunosuppressive effects, and are widely used for regenerative medicine and immune disorders. AIMS OF STUDY: This study investigated the effects of Astragalus polysaccharides (APS) on umbilical cord-derived MSCs (UCMSCs), including morphology, surface marker expression, proliferation, differentiation, and in-vitro and in-vivo immunosuppressive capacities...
June 23, 2017: Journal of Ethnopharmacology
https://www.readbyqxmd.com/read/28646815/integrative-treatment-of-chronic-abdominal-bloating-and-pain-associated-with-overgrowth-of-small-intestinal-bacteria-a-case-report
#17
Laura Kwiatkowski, Elizabeth Rice, Jeffrey Langland
Context • Small intestinal bacterial overgrowth (SIBO) is commonly defined as an increased number of bacteria and/or an abnormal type of bacteria in the small intestine. Conventional treatment for SIBO is typically focused on antibiotics to eradicate the bacterial overgrowth. Numerous studies have demonstrated the antimicrobial activity of herbs, and a diet low in fermentable oligo-, di-, and monosaccharides and polyols (FODMAPs) has been shown to enhance antibiotic therapy. Objective • The current case study intended to evaluate the benefits of an alternative, multifaceted approach-including botanical and homeopathic therapies in conjunction with a low-FODMAP diet-in the treatment of SIBO and its associated symptoms...
July 2017: Alternative Therapies in Health and Medicine
https://www.readbyqxmd.com/read/28639115/chemical-composition-of-selected-commercial-herbal-remedies-in-relation-to-geographical-origin-and-inter-species-diversity
#18
Pawel Konieczynski, Agnieszka Viapiana, Roman Lysiuk, Marek Wesolowski
Infusions prepared from medicinal herbs that are rich in flavonoids are very popular herbal remedies in societies of Eastern Europe. Therefore, the content of essential elements together with total flavonoids was analyzed in 65 commercially available samples of herbal drugs originating from Ukraine, Romania, and Belarus. The results showed that metallic elements (in mg kg(-1) d.w.) have occurred in the following order: Fe > Mn > Zn > Cu, both for total and water-extractable species. Total flavonoids were determined in the range from 10...
June 21, 2017: Biological Trace Element Research
https://www.readbyqxmd.com/read/28636884/major-achievements-of-evidence-based-traditional-chinese-medicine-in-treating-major-diseases
#19
REVIEW
Jung Chao, Yuntao Dai, Robert Verpoorte, Wing Lam, Yung-Chi Cheng, Li-Heng Pao, Wei Zhang, Shilin Chen
A long history of use and extensive documentation of the clinical practices of traditional Chinese medicine resulted in a considerable number of classical preparations, which are still widely used. This heritage of our ancestors provides a unique resource for drug discovery. Already, a number of important drugs have been developed from traditional medicines, which in fact form the core of Western pharmacotherapy. Therefore, this article discusses the differences in drug development between traditional medicine and Western medicine...
June 19, 2017: Biochemical Pharmacology
https://www.readbyqxmd.com/read/28634392/the-traditional-chinese-medicine-achyranthes-bidentata-and-our-de-novo-conception-of-its-metastatic-chemoprevention-from-phytochemistry-to-pharmacology
#20
Zhou Jiang, Jun Qian, Haiyan Dong, Jingyi Yang, Xiaobo Yu, Jianzhong Chen, Hongning Chen, Qing Shi, Lee Jia
Our recent biosystems analysis revealed similarities between embryonic implantation and cancer cell adhesion, which suggests that abortifacients may be good for safe and effective metastatic chemoprevention targeting circulating tumor cells (CTC). Here we test the hypothesis by using the well-known abortion herb Achyranthes bidentata Blume (A. bidentata). Five compounds were separated from the herb root. Among them, ginsenoside Ro was the most potent in inhibiting embryonic implantation within non-cytotoxic concentrations...
June 20, 2017: Scientific Reports
keyword
keyword
121120
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"