Read by QxMD icon Read

Phylogenic tree

C Corlouer, B Lamy, M Desroches, J Ramos-Vivas, E Mehiri-Zghal, O Lemenand, J-M Delarbre, J-W Decousser
BACKGROUND: Stenotrophomonas maltophilia is an opportunistic multi-drug-resistant bacterium responsible for healthcare-associated infections. Strategies for in-hospital infection control and management of carriers and environmental reservoirs remain controversial. AIM: To determine the population structure of S. maltophilia strains in hospitalized infected patients and to identify putative highly pathogenic subpopulations that require upgraded infection control measures...
February 9, 2017: Journal of Hospital Infection
Zhuo Shen, Xiu-Mei Dong, Zhi-Fang Gao, Qing Chao, Bai-Chen Wang
In C4 plants, phosphoenolpyruvate carboxykinase (PEPCK) plays a key role in the C4 cycle. PEPCK is also involved in gluconeogenesis and is conserved in both lower and higher organisms, including in animals and plants. A phylogenic tree constructed from PEPCK sequences from bacteria to higher plants indicates that the C4 Poaceae PEPCKs are conserved and have diverged from the PEPCKs of C3 plants. The maximum enzymatic activities of wild-type and phosphorylation mimic PEPCK proteins indicate that there is a significant difference between C3 and C4 plant PEPCKs...
February 27, 2017: Journal of Plant Physiology
Han Sun, Xiangping Wang, Yanwen Fan, Chao Liu, Peng Wu, Qiaoyan Li, Weilun Yin
Whether there is a general allometry law across plant species with different sizes and under different environment has long been controversial and shrubs are particularly useful to examine these questions. Here we sampled 939 individuals from 50 forest shrub species along a large altitudinal gradient. We tested several allometry models with four relationships simultaneously (between stem diameter, height, leaf, stem and aboveground biomass), including geometric, elastic and stress similarity, and metabolic scaling theory's predictions on small plants (MSTs) and trees (MSTt)...
March 7, 2017: Scientific Reports
Xiaohong Zhang, Jinfeng Hao, Y U Xia, Yage Chang, Daochuan Zhang, Hong Yin
The higher taxa classification and phylogeny of the insect order Orthoptera have long been controversial. Hexamerin, as a member of the highly conserved arthropod hemocyanin superfamily, has been shown to be a good marker for the phylogenetic study of insects. However, few studies have used hexamerins on the phylogeny of Orthoptera. In this study, we determined twenty-seven different hexamerin subunit type sequences in seventeen speices of Orthoptera. In order to infer the phylogenetic relationships among the superfamilies within Orthoptera and test the monophyly of Orthoptera, phylogenic trees were reconstructed using Neighbor-Joining (NJ) and Bayesian inference (BI) methods with two dipluran and three hymenopteran hexamerin sequences as outgroups...
February 20, 2017: Zootaxa
R Ravinder, N Goyal
LIM domains are zinc-binding motifs that mediate protein-protein interactions and are found in a wide variety of cytoplasmic and nuclear proteins. The nuclear LIM domain family members have a number of different functions including transcription factors, gene regulation, cell fate determination, organization of the cytoskeleton and tumour formation exerting their function through various LIM domain interacting protein partners/cofactors. Nuclear LIM domain interacting proteins/factors have not been reported in any protozoan parasites including Leishmania...
February 7, 2017: Gene
Hieu Duc Nguyen, Tuan Anh Bui, Phuong Thanh Nguyen, Oanh Thi Phuong Kim, Thuy Thi Bich Vo
Objective: The I pig is a long nurtured longstanding breed in Vietnam, and contains excellent indigenous genetic resources. However, after 1970s, I pig breeds have become a small population because of decreasing farming areas and increasing pressure from foreign breeds with a high growth rate. Thus, there is now the risk of the disappearance of the I pigs breed. The aim of this study was to focus on classifying and identifying the I pig genetic origin and supplying molecular makers for conservation activities...
December 27, 2016: Asian-Australasian Journal of Animal Sciences
Alexa A Stephen, Angelique M Leone, David E Toplon, Linda L Archer, James F X Wellehan
A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay...
December 2016: Journal of Avian Medicine and Surgery
Mitchell Wendt, Gang-Joon Heo
Our research sought to characterize the phylogeny of Pseudomonas aeruginosa isolated from pet Chinese stripe-necked turtles (Ocadia sinensis) to better understand its evolutionary relation to other isolates and increase understanding of a potential zoonotic pathogen transmitted through direct contact with pet turtles. Thirty-one Pseudomonas aeruginosa isolates were obtained from both immature and adult turtles sold in pet shops in Korea. To characterize the phylogenic position of Chinese stripe-necked turtle-borne P...
December 2016: Laboratory Animal Research
Qin Qiao, Li Xue, Qia Wang, Hang Sun, Yang Zhong, Jinling Huang, Jiajun Lei, Ticao Zhang
Multiple closely related species with genomic sequences provide an ideal system for studies on comparative and evolutionary genomics, as well as the mechanism of speciation. The whole genome sequences of six strawberry species (Fragaria spp.) have been released, which provide one of the richest genomic resources of any plant genus. In this study, we first generated seven transcriptome sequences of Fragaria species de novo, with a total of 48,557-82,537 unigenes per species. Combined with 13 other species genomes in Rosales, we reconstructed a phylogenetic tree at the genomic level...
2016: Frontiers in Plant Science
Yun Wang, Xin Liu, Shuai Lv, Jinnan Ren, Fei Ke
Cathepsin S, a papain-like cysteine peptidase, is an important regulator and signaling molecule with diverse biological actions in addition to immune presentation. However, our understanding of its structure and properties remains limited. Herein, a full-length cathepsin Sa from yellow catfish was cloned and named PfCTSSa. It contained 1366 bp, including a 981 bp ORF flanked by a 123 bp 5'-untranslated region (UTR) and a 262 bp 3'-UTR. This ORF encoded a 36.5 kD cysteine protease with the deduced amino acid sequence having a 76% sequence identity with Ictalurus punctatus ctssa...
February 2017: Fish & Shellfish Immunology
Claudia Raja Gabaglia
PURPOSE OF REVIEW: The purpose of this review is to present what is known about the Zika virus (ZIKV) at the time of writing this review. The viral structure and its phylogeny, as well as the limitations of current available techniques used for diagnosis, are discussed. RECENT FINDINGS: Crystallography and cryo-electron microscopy of the whole ZIKV, or a few of its proteins, are confirming its overall antigenic relatedness to other flaviviruses. Sequencing has revealed its dynamic genetic variation and has placed the Western cluster of Zika isolates within the Asian phylogenic tree...
February 2017: Current Opinion in Pediatrics
S Tamadoni Jahromi, S A Mohd Noor, K Pirian, R Dehghani, M Nazemi, A Khazaali
In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%)...
2016: Iranian journal of veterinary research
Ting Wang, Jie Meng, Li Li, Guofan Zhang
Hypoxia-inducible factor (HIF), a critical member of the basic-helix-loop-helix (bHLH)-containing Per-Arnt-Sim (PAS) protein family, is a master transcription factor involved in maintaining oxygen homeostasis. In the present study, we isolated and characterized a novel bHLH-PAS family member, CgHIFα-like gene, from the Pacific oyster Crassostrea gigas, and determined its importance during hypoxia stress. The 3020-bp CgHIFα-like cDNA encoded a protein of 888 amino acids. The predicted CgHIFα-like amino acid sequence was conserved in the N-terminal bHLH, PAS, and PAC domains (but not in the C-terminal domain) and was most closely related to the HIF family in the bHLH-PAS protein phylogenic tree...
2016: PloS One
Van N T Nguyen, Kieu T X Vo, Hyon Park, Jong-Seong Jeon, Ki-Hong Jung
The Mildew resistance Locus O (MLO) family is unique to plants, containing genes that were initially identified as a susceptibility factor to powdery mildew pathogens. However, little is known about the roles and functional diversity of this family in rice, a model crop plant. The rice genome has 12 potential MLO family members. To achieve systematic functional assignments, we performed a phylogenomic analysis by integrating meta-expression data obtained from public sources of microarray data and real-time expression data into a phylogenic tree...
2016: Frontiers in Plant Science
L Ming, L Yi, F C Guo, S Siriguleng, J Jirimutu
The Bactrian camel is an important domesticated animal providing milk, meat, and other products in desert countries. In this study, 111 individuals representing 11 domestic Bactrian camel breeds from China, Mongolia, Russia, and one wild Bactrian camel group from Mongolia were selected for the preparation of mitochondrial DNA. The 1140-bp fragments of the cytochrome b gene (Cytb) were amplified by polymerase chain reaction and sequenced directly. Sequences of the 92 domestic and 19 wild Bactrian camel samples were analyzed with DNASTAR, and a phylogenic tree was constructed using MEGA...
September 19, 2016: Genetics and Molecular Research: GMR
Tatsuya Tada, Pham Hong Nhung, Tohru Miyoshi-Akiyama, Kayo Shimada, Mitsuhiro Tsuchiya, Doan Mai Phuong, Nguyen Quoc Anh, Norio Ohmagari, Teruo Kirikae
Forty clinical isolates of multidrug-resistant Pseudomonas aeruginosa were obtained in a medical setting in Hanoi, Vietnam. Whole genomes of all 40 isolates were sequenced by MiSeq (Illumina), and phylogenic trees were constructed from the single nucleotide polymorphism concatemers. Of these 40 isolates, 24 (60.0%) harbored metallo-β-lactamase-encoding genes, including blaIMP-15, blaIMP-26, blaIMP-51, and/or blaNDM-1 Of these 24 isolates, 12 harbored blaIMP-26 and belonged to sequence type 235 (ST235). Escherichia coli expressing blaIMP-26 was significantly more resistant to doripenem and meropenem than E...
November 2016: Antimicrobial Agents and Chemotherapy
Maxime Hebrard, Todd D Taylor
Metagenomic samples can contain hundreds or thousands of different species. The most common method to identify these species is to sequence the samples and then classify the reads to nodes along a phylogenic tree. Linear representations of trees with so many nodes face legibility issues. In addition, such views are not optimal for appreciating the read quantity assigned to each node. The problem is exaggerated when comparison between multiple samples is needed. MetaTreeMap adapts a visualization method that addresses these weaknesses...
2016: PloS One
Tuan Manh Nguyen, Seung-Woon Myung, Hyein Jang, Jaisoo Kim
A novel yellow bacterial strain, designated UCM-28T, was isolated from forest soil in Gyeonggi-Do, South Korea. The isolated strain was Gram-stain-negative, aerobic, non-spore-forming, non-motile and rod-shaped, and grew at 10-37 °C, pH 5.5-9 and with 0-1 % NaCl. It could reduce nitrate to nitrite and hydrolyse aesculin. We determined the taxonomic position of strain UCM-28T; based on the 16S rRNA gene sequence, the strain belongs to the genus Novosphingobium. The bacterium showed the highest similarity to Novosphingobiumpiscinae SLH-16T (98...
September 2016: International Journal of Systematic and Evolutionary Microbiology
Alberto Oliveira, Pammella Teixeira, Marcela Azevedo, Syed Babar Jamal, Sandeep Tiwari, Sintia Almeida, Artur Silva, Debmalya Barh, Elaine Maria Seles Dorneles, Dionei Joaquim Haas, Marcos Bryan Heinemann, Preetam Ghosh, Andrey Pereira Lage, Henrique Figueiredo, Rafaela Salgado Ferreira, Vasco Azevedo
BACKGROUND: Corynebacterium pseudotuberculosis can be classified into two biovars or biovars based on their nitrate-reducing ability. Strains isolated from sheep and goats show negative nitrate reduction and are termed biovar Ovis, while strains from horse and cattle exhibit positive nitrate reduction and are called biovar Equi. However, molecular evidence has not been established so far to understand this difference, specifically if these C. pseudotuberculosis strains are under an evolutionary process...
June 2, 2016: BMC Microbiology
Wenqiang Zhang, Xiaojuan Lin, Ping Jiang, Zexin Tao, Xiaolin Liu, Feng Ji, Tongzhan Wang, Suting Wang, Hui Lv, Aiqiang Xu, Haiyan Wang
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively...
August 2016: Archives of Virology
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"