Read by QxMD icon Read

Phylogenic tree

Van N T Nguyen, Kieu T X Vo, Hyon Park, Jong-Seong Jeon, Ki-Hong Jung
The Mildew resistance Locus O (MLO) family is unique to plants, containing genes that were initially identified as a susceptibility factor to powdery mildew pathogens. However, little is known about the roles and functional diversity of this family in rice, a model crop plant. The rice genome has 12 potential MLO family members. To achieve systematic functional assignments, we performed a phylogenomic analysis by integrating meta-expression data obtained from public sources of microarray data and real-time expression data into a phylogenic tree...
2016: Frontiers in Plant Science
L Ming, L Yi, F C Guo, S Siriguleng, J Jirimutu
The Bactrian camel is an important domesticated animal providing milk, meat, and other products in desert countries. In this study, 111 individuals representing 11 domestic Bactrian camel breeds from China, Mongolia, Russia, and one wild Bactrian camel group from Mongolia were selected for the preparation of mitochondrial DNA. The 1140-bp fragments of the cytochrome b gene (Cytb) were amplified by polymerase chain reaction and sequenced directly. Sequences of the 92 domestic and 19 wild Bactrian camel samples were analyzed with DNASTAR, and a phylogenic tree was constructed using MEGA...
September 19, 2016: Genetics and Molecular Research: GMR
Tatsuya Tada, Pham Hong Nhung, Tohru Miyoshi-Akiyama, Kayo Shimada, Mitsuhiro Tsuchiya, Doan Mai Phuong, Nguyen Quoc Anh, Norio Ohmagari, Teruo Kirikae
Forty clinical isolates of multidrug-resistant Pseudomonas aeruginosa were obtained in a medical setting in Hanoi, Vietnam. Whole genomes of all 40 isolates were sequenced by MiSeq (Illumina), and phylogenic trees were constructed from the single nucleotide polymorphism (SNP) concatemers. Of these 40 isolates, 24 (60.0%) harbored metallo-β-lactamase encoding genes, including blaIMP-15, blaIMP-26, blaIMP-51, and/or blaNDM-1 Of them, 12 isolates harbored blaIMP-26 and belonged to ST235. Escherichia coli expressing blaIMP-26 was significantly more resistant to doripenem and meropenem than E...
September 6, 2016: Antimicrobial Agents and Chemotherapy
Maxime Hebrard, Todd D Taylor
Metagenomic samples can contain hundreds or thousands of different species. The most common method to identify these species is to sequence the samples and then classify the reads to nodes along a phylogenic tree. Linear representations of trees with so many nodes face legibility issues. In addition, such views are not optimal for appreciating the read quantity assigned to each node. The problem is exaggerated when comparison between multiple samples is needed. MetaTreeMap adapts a visualization method that addresses these weaknesses...
2016: PloS One
Tuan Manh Nguyen, Seung-Woon Myung, Hyein Jang, Jaisoo Kim
A novel yellow bacterial strain, designated UCM-28T, was isolated from forest soil in Gyeonggi-Do, South Korea. The isolated strain was gram-negative, aerobic, non-spore-forming, non-motile, and rod-shaped and grew at 10-37C, pH of 5.5-9, and 0-1% NaCl. It could reduce nitrate to nitrite and hydrolyse esculin. We determined the taxonomic position of strain UCM-28T; based on the 16S rRNA gene sequence, the strain belongs to the genus Novosphingobium. The bacterium showed the highest similarity to Novosphingobium piscinae SLH-16T (98...
June 14, 2016: International Journal of Systematic and Evolutionary Microbiology
Alberto Oliveira, Pammella Teixeira, Marcela Azevedo, Syed Babar Jamal, Sandeep Tiwari, Sintia Almeida, Artur Silva, Debmalya Barh, Elaine Maria Seles Dorneles, Dionei Joaquim Haas, Marcos Bryan Heinemann, Preetam Ghosh, Andrey Pereira Lage, Henrique Figueiredo, Rafaela Salgado Ferreira, Vasco Azevedo
BACKGROUND: Corynebacterium pseudotuberculosis can be classified into two biovars or biovars based on their nitrate-reducing ability. Strains isolated from sheep and goats show negative nitrate reduction and are termed biovar Ovis, while strains from horse and cattle exhibit positive nitrate reduction and are called biovar Equi. However, molecular evidence has not been established so far to understand this difference, specifically if these C. pseudotuberculosis strains are under an evolutionary process...
2016: BMC Microbiology
Wenqiang Zhang, Xiaojuan Lin, Ping Jiang, Zexin Tao, Xiaolin Liu, Feng Ji, Tongzhan Wang, Suting Wang, Hui Lv, Aiqiang Xu, Haiyan Wang
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively...
August 2016: Archives of Virology
Ramin Mazaheri Nezhad Fard, Seyed Milad Vahedi, Iraj Ashrafi, Faranak Alipour, Golnaz Sharafi, Hesam Akbarein, Seyed Javid Aldavood
One of the most important species of the Bartonella genus is B. henselae that causes a zoonotic infection, cat scratch disease (CSD). The main source of the bacteria is cat and the carrier is Ctenocephalides felis flea. One hundred and forty nail and saliva samples were collected from 70 domestic cats. Positive samples for B. henselae were characterized by polymerase chain reaction (PCR) and sequencing. Sequences of gltA gene were trimmed using BioEdit software and then compared with the sequences of the same gene from B...
2016: Veterinary Research Forum
Elizabeth Klemm, Gordon Dougan
The development of next-generation sequencing as a cost-effective technology has facilitated the analysis of bacterial population structure at a whole-genome level and at scale. From these data, phylogenic trees have been constructed that define population structures at a local, national, and global level, providing a framework for genetic analysis. Although still at an early stage, these approaches have yielded progress in several areas, including pathogen transmission mapping, the genetics of niche colonization and host adaptation, as well as gene-to-phenotype association studies...
May 11, 2016: Cell Host & Microbe
Ismail Poyraz
ITS, RAPD-PCR and ISSR-PCR are most popular DNA-based techniques that are extensively applied in the determination of the genetic diversity of species among populations. However, especially for organisms having high genetic polymorphism, phylogenetic trees drawn from the results of these techniques may be different. For finding a meaningful phylogenetic tree, it should be compared phylogenetic trees obtained from these different techniques with geographic locations of populations. Lichens have a high genetic polymorphism and tolerance against different environmental conditions...
May 2016: Comptes Rendus Biologies
Tracey A Bodo Slotta, David P Horvath, Michael E Foley
Weedy invasive Cirsium spp. are widespread in temperate regions of North America and some of their biological control agents have attacked native Cirsium spp. A phylogenetic tree was developed from DNA sequences for the internal transcribed spacer and external transcribed spacer regions from native and non-native Great Plains Cirsium spp. and other thistles to determine if host specificity follows phylogeny. The monophyly of Cirsium spp. and Carduus within the tribe Cardinae was confirmed with native North American and European lineages of the Cirsium spp...
2012: Plants (Basel, Switzerland)
Mala Nurilmala, Yoshihiro Ochiai
The primary structure of southern bluefin tuna Thunnus maccoyii Mb has been elucidated by molecular cloning techniques. The cDNA of this tuna encoding Mb contained 776 nucleotides, with an open reading frame of 444 nucleotides encoding 147 amino acids. The nucleotide sequence of the coding region was identical to those of other bluefin tunas (T. thynnus and T. orientalis), thus giving the same amino acid sequences. Based on the deduced amino acid sequence, bioinformatic analysis was performed including phylogenic tree, hydropathy plot and homology modeling...
October 2016: Fish Physiology and Biochemistry
Koichi Hori, Takashi Nobusawa, Tei Watanabe, Yuka Madoka, Hideyuki Suzuki, Daisuke Shibata, Mie Shimojima, Hiroyuki Ohta
In photosynthetic organisms, the photosynthetic membrane constitutes a scaffold for light-harvesting complexes and photosynthetic reaction centers. Three kinds of glycolipids, namely monogalactosyldiacylglycerol, digalactosyldiacylglycerol, and sulfoquinovosyldiacylglycerol, constitute approximately 80-90% of photosynthetic membrane lipids and are well conserved from tiny cyanobacteria to the leaves of huge trees. These glycolipids perform a wide variety of functions beyond biological membrane formation. In particular, the capability of adaptation to harsh environments through regulation of membrane glycolipid composition is essential for healthy growth and development of photosynthetic organisms...
September 2016: Biochimica et Biophysica Acta
Michael R May, Brian R Moore
Evolutionary biologists have long been fascinated by the extreme differences in species numbers across branches of the Tree of Life. This has motivated the development of statistical methods for detecting shifts in the rate of lineage diversification across the branches of phylogenic trees. One of the most frequently used methods,MEDUSA, explores a set of diversification-rate models, where each model assigns branches of the phylogeny to a set of diversification-rate categories. Each model is first fit to the data, and the Akaike Information Criterion (AIC) is then used to identify the optimal diversification model...
April 1, 2016: Systematic Biology
Naoyuki Kamatani
Genomic data are now available from various fields of medicine and biology, and I proposed a conceptual framework "Six-layer structure" to integrate various areas of genomics. The proposed layers are "life" as the uppermost layer, followed by "species","population","family","individual",and finally "cell" as the bottommost layer. In each pair of adjacent layers, each member of the upper layer comprises a set of members of the lower layer. In each layer, we can define consistent partial orders of members based on genomic data in the forms of phylogenic and pedigree trees...
April 2016: Clinical Calcium
Oshrat Levy-Ontman, Merav Fisher, Yoram Shotland, Yoram Tekoah, Shoshana Malis Arad
N-glycosylation of proteins is one of the most important post-translational modifications that occur in various organisms, and is of utmost importance for protein function, stability, secretion, and loca-lization. Although the N-linked glycosylation pathway of proteins has been extensively characterized in mammals and plants, not much information is available regarding the N-glycosylation pathway in algae. We studied the α 1,3-glucosidase glucosidase II (GANAB) glycoenzyme in a red marine microalga Porphyridium sp...
December 2015: Journal of Phycology
D C Savi, R Aluizio, L Galli-Terasawa, V Kava, C Glienke
The genus Microbispora has been considered difficult to define taxonomically. While 16S rRNA gene analysis is required to determine phylogenetic relationships among species in this genus, most 16S rRNA gene-based phylogenetic tree topologies are not reliable. The genus Microbispora currently contains eight species along with six reclassified species (Microbispora chromogenes, Microbispora diastatica, Microbispora parva, Microbispora indica, Microbispora karnatakensis, Microbispora rosea) and Microbispora rosea subsp...
June 2016: Antonie Van Leeuwenhoek
Farzad Khademi, Fahimeh Ghanbari, Alexander Mellmann, Mohammad J Najafzadeh, Azad Khaledi
The spa gene occurs in all strains of Staphylococcus aureus (S. aureus), can function as a genetic marker and might be used distinguish strains at the species level. Hence, due to these advantages, we used spa typing and the Based Upon Repeat Pattern (BURP) to assign the clonal and phylogenetic relationships of S. aureus strains. The sensitivity of S. aureus strains to methicillin was determined using agar disk diffusion. The extracted DNA from 56 isolates of S. aureus was subjected to PCR to detect the spa gene with specific primers...
September 2016: Journal of Infection and Public Health
Peng Tao, Weiling Guo, Biyuan Li, Wuhong Wang, Zhichen Yue, Juanli Lei, Yanting Zhao, Xinmin Zhong
NADP-dependent malic enzymes (NADP-MEs) play essential roles in both normal development and stress responses in plants. Here, genome-wide analysis was performed to identify 65 putative NADP-ME genes from 12 crucifer species. These NADP-ME genes were grouped into five categories of syntenic orthologous genes and were divided into three clades of a phylogenic tree. Promoter motif analysis showed that NADP-ME1 genes in Group IV were more conserved with each other than the other NADP-ME genes in Groups I and II...
June 2016: Molecular Genetics and Genomics: MGG
Eui-Ju Hong, Cheolho Sim, Joon-Seok Chae, Hyeon-Cheol Kim, Jinho Park, Kyoung-Seong Choi, Do-Hyeon Yu, Jae-Gyu Yoo, Bae-Keun Park
Nematomorpha, horsehair or Gordian worms, include about 300 freshwater species in 22 genera (Gordiida) and 5 marine species in 1 marine genus (Nectonema). They are parasitic in arthropods during their juvenile stage. In the present study, the used gordian worm was found in the feces of a dog (5-month old, male) in July 2014. Following the worm analysis using light and scanning electron microscopes, the morphological classification was re-evaluated with molecular analysis. The worm was determined to be a male worm having a bi-lobed tail and had male gonads in cross sections...
December 2015: Korean Journal of Parasitology
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"