keyword
MENU ▼
Read by QxMD icon Read
search

Raw

keyword
https://www.readbyqxmd.com/read/28728404/quality-of-steak-restructured-from-beef-trimmings-containing-microbial-transglutaminase-and-impacted-by-freezing-and-grading-by-fat-level
#1
Supaluk Sorapukdee, Pussadee Tangwatcharin
Objective: The objective of this research was to evaluate the physico-chemical, microbiological and sensorial qualities of restructured steaks processed from beef trimmings (grade I and II) and frozen beef (fresh beef as control and frozen beef). Method: Beef trimmings from commercial butcher were collected, designated into 4 treatments differed in beef trimmings grade and freezing, processed into restructured steaks with 1% microbial transglutaminase and then analyzed product quality...
July 17, 2017: Asian-Australasian Journal of Animal Sciences
https://www.readbyqxmd.com/read/28728396/characterization-and-functional-inferences-of-a-genome-wide-dna-methylation-profile-in-the-loin-longissimus-dorsi-muscle-of-swine
#2
Woonsu Kim, Hyesun Park, Kang-Seok Seo, Seongwon Seo
Objective: DNA methylation plays a major role in regulating the expression of genes related to traits of economic interest (e.g., weight gain) in livestock animals. This study characterized and investigated the functional inferences of genome-wide DNA methylome in the loin (longissimus dorsi) muscle (LDM) of swine. Methods: A total of 8.99 Gb methylated DNA immunoprecipitation sequence data were obtained from LDM samples of eight Duroc pigs (four pairs of littermates)...
May 14, 2017: Asian-Australasian Journal of Animal Sciences
https://www.readbyqxmd.com/read/28728122/mutagenicity-and-estrogenicity-of-raw-water-and-drinking-water-in-an-industrialized-city-in-the-yangtze-river-delta
#3
Sanhua Xiao, Xuemin Lv, Yifan Zeng, Tao Jin, Lan Luo, Binbin Zhang, Gang Zhang, Yanhui Wang, Lin Feng, Yuan Zhu, Fei Tang
Public concern was aroused by frequently reported water pollution incidents in Taihu Lake and the Yangtze River. The pollution also caught and sustained the attention of the scientific community. From 2010 to 2016, raw water and drinking water samples were continually collected at Waterworks A and B (Taihu Lake) and Waterworks C (Yangtze River). The non-volatile organic pollutants in the water samples were extracted by solid phase extraction. Ames tests and yeast estrogen screen (YES) assays were conducted to evaluate the respective mutagenic and estrogenic effects...
July 14, 2017: Chemosphere
https://www.readbyqxmd.com/read/28727648/is-something-missing-from-antenatal-education-a-survey-of-pregnant-women-s-knowledge-of-pelvic-floor-disorders
#4
Julia M Geynisman-Tan, Debra Taubel, Tirsit S Asfaw
OBJECTIVE: This study aimed to describe the knowledge on pelvic floor disorders among a cross section of pregnant women. STUDY DESIGN: This was an institutional review board-approved cross-sectional survey study of pregnant women with a gestational age of more than 18 weeks at a single tertiary care institution. Participants completed the validated 24-item Prolapse and Incontinence Knowledge Questionnaire, and responses were graded to determine a raw accuracy score (0-100%)...
July 20, 2017: Female Pelvic Medicine & Reconstructive Surgery
https://www.readbyqxmd.com/read/28727252/frapbot-an-open-source-application-for-frap-data
#5
Robin Kohze, Cindy E J Dieteren, Werner J H Koopman, Roland Brock, Samuel Schmidt
We introduce Frapbot, a free-of-charge open source software web application written in R, which provides manual and automated analyses of fluorescence recovery after photobleaching (FRAP) datasets. For automated operation, starting from data tables containing columns of time-dependent intensity values for various regions of interests within the images, a pattern recognition algorithm recognizes the relevant columns and identifies the presence or absence of prebleach values and the time point of photobleaching...
July 20, 2017: Cytometry. Part A: the Journal of the International Society for Analytical Cytology
https://www.readbyqxmd.com/read/28727158/hplc-fingerprinting-approach-for-raw-material-assesment-and-unit-operation-tracking-for-ivig-production-from-cohn-i-ii-iii-fraction
#6
Sebastijan Peljhan, Tina Jakop, Dunja Šček, Vid Skvarča, Blaž Goričar, Romina Žabar, Nina Mencin
The plasma derived immunoglobulin G (IgG) used either for diagnostic purpose or intravenous application (in form of IVIG) in various medical therapies is certainly gaining more and more attention on annual basis. Different manufacturing processes are used to isolate immunoglobulins from human plasma. However, a quest for alternative paths in IgG isolation not only requires development of the most efficient isolation process, but also a rapid and reliable analytics to track the purification. Fast and reliable fingerprint-based method for characterization of IgG prepared from Cohn I+II+III paste is presented in this paper...
July 20, 2017: Electrophoresis
https://www.readbyqxmd.com/read/28727127/the-assessment-of-overall-survival-os-after-adjuvant-chemotherapy-for-patients-with-malignant-endometrial-cancer-in-poland
#7
Zbigniew Teter, Andrzej Śliwczyński, Melania Brzozowska, Marcin Świerkowski, Andrzej Jacyna, Jarosław Pinkas, Aleksandra Sierocka, Michał Marczak, Anna Dańska-Bidzińska, Mariusz Bidziński, Waldemar Wierzba
OBJECTIVES: In 2013 malignant endometrial cancers have amounted to 7.3% of all cancers diagnosed among women in the report by the Polish National Cancer Registry Raw prevalence rate amounted to 28.7, whereas standardised prevalence rate 15.6 per 100 000 population. Among the causes of death, these cancers amounted to 3% and were ranked ninth on the list of the most common causes of oncologic mortality of women. In the year 2013 a total of 1243 women died of malignant endometrial cancers...
2017: Ginekologia Polska
https://www.readbyqxmd.com/read/28727037/assessment-of-objective-measures-of-beef-steak-juiciness-and-their-relationships-to-sensory-panel-juiciness-ratings
#8
L W Lucherk, T G O'Quinn, J F Legako, R J Rathmann, J C Brooks, M F Miller
The objective of this study was to evaluate multiple instrumental measures of beef juiciness and determine their relationships with sensory panel juiciness ratings. Treatments were selected to maximize variation in juiciness and included 5 USDA quality grades (Prime, upper two-thirds Choice, lower one-third Choice, Select, and Standard) as well as 2 enhanced Select treatments (112 and 107% of the initial raw weight) and were prepared to 3 degrees of doneness (DOD; rare [66°C], medium [71°C], and well done [77°C])...
June 2017: Journal of Animal Science
https://www.readbyqxmd.com/read/28726911/feeding-a-sustainable-chemical-industry-do-we-have-the-bioproducts-cart-before-the-feedstocks-horse
#9
Bruce E Dale
A sustainable chemical industry cannot exist at scale without both sustainable feedstocks and feedstock supply chains to provide the raw materials. However, most current research focus is on producing the sustainable chemicals and materials. Little attention is given to how and by whom sustainable feedstocks will be supplied. In effect, we have put the bioproducts cart before the sustainable feedstocks horse. For example, bulky, unstable, non-commodity feedstocks such as crop residues probably cannot supply a large-scale sustainable industry...
July 20, 2017: Faraday Discussions
https://www.readbyqxmd.com/read/28726751/an-adaptive-feature-learning-model-for-sequential-radar-high-resolution-range-profile-recognition
#10
Xuan Peng, Xunzhang Gao, Yifan Zhang, Xiang Li
This paper proposes a new feature learning method for the recognition of radar high resolution range profile (HRRP) sequences. HRRPs from a period of continuous changing aspect angles are jointly modeled and discriminated by a single model named the discriminative infinite restricted Boltzmann machine (Dis-iRBM). Compared with the commonly used hidden Markov model (HMM)-based recognition method for HRRP sequences, which requires efficient preprocessing of the HRRP signal, the proposed method is an end-to-end method of which the input is the raw HRRP sequence, and the output is the label of the target...
July 20, 2017: Sensors
https://www.readbyqxmd.com/read/28726573/investigating-variations-of-fluorescent-dissolved-organic-matter-in-wastewater-treatment-using-synchronous-fluorescence-spectroscopy-combined-with-principal-component-analysis-and-two-dimensional-correlation
#11
Hongwei Pan, Huibin Yu, Yanan Wang, Ruixia Liu, Hongjun Lei
Synchronous fluorescence spectroscopy (SFS) combined with principal component analysis (PCA) and two-dimensional (2D) correlation was applied to investigate removal efficiencies and variations of dissolved organic matter (DOM) fractions in the wastewater treatment plant (WWTP) with an A2O craft. A decreasing order of total removal efficiencies was tyrosine-like fluorescence component (89.58%) > humic-like fluorescence component (39.83%) > tryptophan-like fluorescence component (36.89%) > microbial humic-like fluorescence component (12...
July 20, 2017: Environmental Technology
https://www.readbyqxmd.com/read/28726500/chemical-constituents-from-curcuma-longa-l-and-their-inhibitory-effects-of-nitric-oxide-production
#12
Ting Yuan, Cuiyun Zhang, Chongyue Qiu, Guiyang Xia, Fei Wang, Bin Lin, Hua Li, Lixia Chen
A new bisabolane-type sesquiterpenoid, turmerone Q (1), along with six known compounds (2-7), were isolated from the rhizomes of Curcuma longa L. The structural elucidation of the new compound was conducted using (1)H NMR, (13)C NMR, HSQC, HMBC and NOESY spectroscopic analyses. The absolute configuration of 1 was elucidated by comparison of the experimental and calculated ECD spectra. The anti-inflammatory effects of 1-7 were evaluated through lipopolysaccharide-induced nitric oxide (NO) production in RAW 264...
July 20, 2017: Natural Product Research
https://www.readbyqxmd.com/read/28726414/citrifurans-a-d-four-dimeric-aromatic-polyketides-with-new-carbon-skeletons-from-the-fungus-aspergillus-sp
#13
Guo-Ping Yin, Ya-Rong Wu, Ming-Hua Yang, Tian-Xiao Li, Xiao-Bing Wang, Miao-Miao Zhou, Jian-Li Lei, Ling-Yi Kong
Citrifurans A-D (1-4), metabolized by an Aspergillus sp., are unusual dimers of azaphilone and furanone derivatives. Michael addition was thought to be the pivotal procedure in their biosynthesis, and different addition sites generated two new different carbon skeletons. Their structures were elucidated on the basis of spectroscopic methods, single-crystal X-ray diffraction, chemical conversion, and electronic circular dichroism analyses. Compounds 1-3 showed moderate inhibitory activities against LPS-induced NO production in RAW 264...
July 20, 2017: Organic Letters
https://www.readbyqxmd.com/read/28725904/cellular-antioxidant-methylglyoxal-trapping-and-anti-inflammatory-activities-of-cocoa-tea-camellia-ptilophylla-chang
#14
Xiong Gao, Xiaorong Lin, Xiaofei Li, Yuanyuan Zhang, Zhongzheng Chen, Bin Li
Cocoa tea (Camellia ptilophylla Chang) is a naturally low caffeine-containing but gallocatechin gallate (GCG)-rich tea cultivar, though its biological activities have not been extensively explored. Herein, we evaluated the in vitro cellular antioxidant, methylglyoxal trapping, and anti-inflammatory activities of water extract of green tea from cocoa tea (CWE) and Yunnan Daye tea (Camellia sinensis) (YWE), and their predominant bioactive components GCG and epigallocatechin gallate (EGCG) for comparative purposes...
July 20, 2017: Food & Function
https://www.readbyqxmd.com/read/28725868/physico-mechanical-thermal-and-morphological-properties-of-furfuryl-alcohol-2-ethylhexyl-methacrylate-halloysite-nanoclay-wood-polymer-nanocomposites-wpncs
#15
Md Rezaur Rahman, Sinin Hamdan, Josephine Chang Hui Lai, Mohammad Jawaid, Fahmi Asyadi Bin Md Yusof
In this study, the physical, morphological, mechanical and thermal properties of furfuryl alcohol/2-ethylhexyl methacrylate/halloysite nanoclay wood polymer nanocomposites (FA-co-EHMA-HNC WPNCs) were investigated. FA-co-EHMA-HNC WPNCs were prepared via an impregnation method and the properties of the nanocomposites were characterized through the weight percent gain, Fourier transform infrared (FT-IR) spectroscopy, scanning electron microscopy (SEM), three-point flexural test, dynamic mechanical thermal analysis (DMTA), thermogravimetric analysis (TGA), differential scanning calorimetry (DSC) analysis and moisture absorption test...
July 2017: Heliyon
https://www.readbyqxmd.com/read/28725335/is-peanut-causing-food-allergy-in-cuba-preliminary-assessment-of-allergic-sensitization-and-ige-specificity-profile-to-peanut-allergens-in-cuban-allergic-patients
#16
Mayteé Mateo-Morejón, Alexis Labrada-Rosado, Damaris Torralba-Averoff, Rayza Cruz-Jimenez, Yunia Oliva-Díaz, Mirta Álvarez-Castelló, Alexander Ciria-Martín, Marlene Jiménez-Frandín, Mary Carmen Reyes-Zamora, Raúl Lázaro Castro-Almarales, Beatriz Tamargo-García
BACKGROUND: Peanut allergy is increasing at an alarming pace in developed countries. Peanut (Arachis hypogaea) is a common food in Cuba. Nevertheless, reported values of sensitization and symptom severity are usually low. As our objective, we carried out an evaluation of allergic sensitivity to perform an assessment of allergic sensitization and IgE specificity profile to peanut allergens in Cuban allergic patients. METHODS: The Skin Prick Test (SPT) was performed for each patient, using two glycerinated allergenic extracts, prepared from raw or roasted peanuts...
2017: World Allergy Organization Journal
https://www.readbyqxmd.com/read/28725218/all-new-faces-of-diatoms-potential-source-of-nanomaterials-and-beyond
#17
REVIEW
Meerambika Mishra, Ananta P Arukha, Tufail Bashir, Dhananjay Yadav, G B K S Prasad
Nature's silicon marvel, the diatoms have lately astounded the scientific community with its intricate designs and lasting durability. Diatoms are a major group of phytoplanktons involved in the biogeochemical cycling of silica and are virtually inherent in every environment ranging from water to ice to soil. The usage of diatoms has proved prudently cost effective and its handling neither requires costly materials nor sophisticated instruments. Diatoms can easily be acquired from the environment, their culture requires ambient condition and does not involve any costly media or expensive instruments, besides, they can be transported in small quantities and proliferated to a desirable confluence from that scratch, thus are excellent cost effective industrial raw material...
2017: Frontiers in Microbiology
https://www.readbyqxmd.com/read/28725031/polarization-entangled-photon-pair-sources-based-on-spontaneous-four-wave-mixing-assisted-by-polarization-mode-dispersion
#18
Pisek Kultavewuti, Eric Y Zhu, Xingxing Xing, Li Qian, Vincenzo Pusino, Marc Sorel, J Stewart Aitchison
Photonic-based qubits and integrated photonic circuits have enabled demonstrations of quantum information processing (QIP) that promises to transform the way in which we compute and communicate. To that end, sources of polarization-entangled photon pair states are an important enabling technology. However, such states are difficult to prepare in an integrated photonic circuit. Scalable semiconductor sources typically rely on nonlinear optical effects where polarization mode dispersion (PMD) degrades entanglement...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#19
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28724226/application-of-a-crustacean-bioassay-to-evaluate-a-multi-contaminated-metal-pah-pcb-harbor-sediment-before-and-after-electrokinetic-remediation-using-eco-friendly-enhancing-agents
#20
Y Tian, C Boulangé-Lecomte, A Benamar, N Giusti-Petrucciani, A Duflot, S Olivier, C Frederick, J Forget-Leray, F Portet-Koltalo
Electrokinetic (EK) remediation can be a suitable technology for treating contaminated dredged harbor sediment, stored on terrestrial disposal sites. Citric acid (CA) and biosurfactants (rhamnolipids and saponin) were chosen as enhancing agents for simultaneous metal (Cd, Cr, Cu, Pb, Zn) and PAH/PCB removal by EK because of their potential low toxicity with a view to site restoration. Three EK runs were performed using a periodic voltage (1Vcm(-1)) and various concentrations of agents. The best combination of CA (0...
July 14, 2017: Science of the Total Environment
keyword
keyword
109389
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"