keyword
MENU ▼
Read by QxMD icon Read
search

Technology and Medicine

keyword
https://www.readbyqxmd.com/read/28729428/fluorine-18-labeled-carboplatin-derivative-for-pet-imaging-of-platinum-drug-distribution
#1
Narottam Lamichhane, Gajanan K Dewkar, Sundaresan Gobalakrishnan, Li Wang, Purnima Jose, Muhammad Otabashi, Jean-Luc Morelle, Nicholas Farrell, Jamal Zweit
Increasing evidence indicates that reduced intracellular drug accumulation is the parameter most consistently associated with platinum drug resistance, and emphasizes the need to directly measure intra-tumor drug concentration. In the era of precision medicine and with the advent of powerful imaging and proteomics technologies, there is an opportunity to better understand drug resistance, by exploiting these techniques to provide new knowledge on drug-target interactions. Here, we are contributing to this endeavor by reporting on the development of a fluorine-18 labeled carboplatin derivative ((18)F-FCP) that can be used to potentially image drug uptake and retention, including intra-tumoral distribution, by positron emission tomography (PET)...
July 20, 2017: Journal of Nuclear Medicine: Official Publication, Society of Nuclear Medicine
https://www.readbyqxmd.com/read/28729406/tumor-evolution-as-a-therapeutic-target
#2
REVIEW
Nabil Amirouchene-Angelozzi, Charles Swanton, Alberto Bardelli
Recent technological advances in the field of molecular diagnostics (including blood-based tumor genotyping) allow the measurement of clonal evolution in patients with cancer, thus adding a new dimension to precision medicine: time. The translation of this new knowledge into clinical benefit implies rethinking therapeutic strategies. In essence, it means considering as a target not only individual oncogenes but also the evolving nature of human tumors. Here, we analyze the limitations of targeted therapies and propose approaches for treatment within an evolutionary framework...
July 20, 2017: Cancer Discovery
https://www.readbyqxmd.com/read/28729303/amotosalen-uva-pathogen-inactivation-technology-reduces-platelet-activatability-induces-apoptosis-and-accelerates-clearance
#3
Simona Stivala, Sara Gobbato, Laura Infanti, Martin F Reiner, Nicole Bonetti, Sara C Meyer, Giovanni G Camici, Thomas F Lüscher, Andreas Buser, Jürg H Beer
Amotosalen and ultraviolet A photochemical-based pathogen reduction using the InterceptTM Blood System is an effective and established technology for platelet and plasma components, which is adopted in more than 40 countries worldwide. Several reports point towards a reduced platelet function after Amotosalen/UVA exposure. The current study was undertaken to identify the mechanisms responsible for the early impairment of platelet function by the InterceptTM Blood System. Twenty-five platelet apheresis units were collected from healthy volunteers following standard procedures and split into 2 components, one untreated and the other treated with Amotosalen/UVA...
July 20, 2017: Haematologica
https://www.readbyqxmd.com/read/28729228/tangled-history-of-the-european-uses-of-sphagnum-moss-and-sphagnol
#4
REVIEW
Jacek Drobnik, Adam Stebel
ETHNOPHARMACOLOGICAL RELEVANCE: Sphagnum mosses and peat could have been utilized as wound dressings for centuries, however reliable data on this subject are ambiguous; sometimes even no distinction between peat moss (Sphagnum spp.) and peat is made or these terms become confused. The first scientific account on surgical use of peat comes from 1882: a peat digger who successfully, by himself and in the way unknown to the then medicine, cured an open fracture of his forearm with peat. The peat, and very soon the peat moss itself (which is the major constituent of peat) drew attention of the 19(th)-century surgeons...
July 17, 2017: Journal of Ethnopharmacology
https://www.readbyqxmd.com/read/28729190/systematic-review-of-the-use-of-3-dimensional-printing-in-surgical-teaching-and-assessment
#5
Benjamin Langridge, Sheikh Momin, Ben Coumbe, Evelina Woin, Michelle Griffin, Peter Butler
OBJECTIVE: The use of 3-dimensional (3D) printing in medicine has rapidly expanded in recent years as the technology has developed. The potential uses of 3D printing are manifold. This article provides a systematic review of the uses of 3D printing within surgical training and assessment. METHODS: A structured literature search of the major literature databases was performed in adherence to PRISMA guidelines. Articles that met predefined inclusion and exclusion criteria were appraised with respect to the key objectives of the review and sources of bias were analysed...
July 17, 2017: Journal of Surgical Education
https://www.readbyqxmd.com/read/28727969/fetal-dysmorphology-still-an-essential-art-analysis-of-the-limitations-of-microarray-in-a-fetal-population-and-a-look-toward-the-genome-sequencing-era
#6
E Fletcher, M Porteous, K J McKenzie, E J Maher, M J Evans
Cytogenomic microarray allows assessment of the genome at higher resolutions than traditional karyotyping. The objective of this study is to evaluate the utility of microarray in a routine fetal autopsy setting before the advent of routine fetal exome/genome sequencing and the issues these technologies may generate. A systematic review of fetal postmortems at 12-24 weeks gestation between January 2011 and December 2014 was undertaken. Cases where there was no consent for audit, research, or genetic testing were excluded as were cases referred to the Procurator Fiscal, stillbirths, and neonatal deaths...
July 2017: Pediatric and Developmental Pathology
https://www.readbyqxmd.com/read/28726968/evaluation-of-spectral-photon-counting-computed-tomography-k-edge-imaging-for-determination-of-gold-nanoparticle-biodistribution-in-vivo
#7
Salim Si-Mohamed, David P Cormode, Daniel Bar-Ness, Monica Sigovan, Pratap C Naha, Jean-Baptiste Langlois, Lara Chalabreysse, Philippe Coulon, Ira Blevis, Ewald Roessl, Klaus Erhard, Loic Boussel, Philippe Douek
Spectral photon counting computed tomography (SPCCT) is an emerging medical imaging technology. SPCCT scanners record the energy of incident photons, which allows specific detection of contrast agents due to measurement of their characteristic X-ray attenuation profiles. This approach is known as K-edge imaging. Nanoparticles formed from elements such as gold, bismuth or ytterbium have been reported as potential contrast agents for SPCCT imaging. Furthermore, gold nanoparticles have many applications in medicine, such as adjuvants for radiotherapy and photothermal ablation...
July 20, 2017: Nanoscale
https://www.readbyqxmd.com/read/28725861/pursuing-humanistic-medicine-in-a-technological-age
#8
Stephen Bertman
The humanistic practice of medicine requires that the practitioner have sufficient time and appropriate focus. Both elements, however, are under assault by the high-speed, distraction-filled environment within which primary care is delivered today. Despite or perhaps because of modern medicine's technological advances, the potentially healing bond between doctor and patient is being frayed and the quality of care consequently degraded.
June 2017: Journal of patient experience
https://www.readbyqxmd.com/read/28724933/derivative-technology-of-dna-barcoding-nucleotide-signature-and-snp-double-peak-methods-detects-adulterants-and-substitution-in-chinese-patent-medicines
#9
Zitong Gao, Yang Liu, Xiaoyue Wang, Jingyuan Song, Shilin Chen, Subramanyam Ragupathy, Jianping Han, Steven G Newmaster
Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs...
July 19, 2017: Scientific Reports
https://www.readbyqxmd.com/read/28724557/the-human-virome-implications-for-clinical-practice-in-transplantation-medicine
#10
Susanna K Tan, David A Relman, Benjamin A Pinsky
Advances in DNA sequencing technology have provided an unprecedented opportunity to study the human virome. Transplant recipients and other immunocompromised hosts are at particular risk for developing virus-related pathology; thus, the impact of the virome on health and disease may be even more relevant in this population. Here we discuss technical considerations in studying the human virome, the current literature on the virome in transplant recipients, and near future applications of sequence-based findings that can further our understanding of viruses in transplantation medicine...
July 19, 2017: Journal of Clinical Microbiology
https://www.readbyqxmd.com/read/28724420/legal-access-to-medications-a-threat-to-brazil-s-public-health-system
#11
Ana Luiza Chieffi, Rita De Cassia Barata Barradas, Moisés Golbaum
BACKGROUND: In Brazil, health is fundamental human right guaranteed by the Constitution of 1988, which created the Brazilian Universal Health System (Sistema Único de Saúde - SUS). The SUS provides medications for outpatient care via policy of pharmaceutical assistance (PA) programmes. Despite the advances in PA policies which include the improvement in access to medications, there has been a significant increase in lawsuits related to health products and services. This study aimed to characterize the medication processes filed between 2010 and 2014 against the Secretary of State for Health of São Paulo (State Health Department of São Paulo - SES/SP), in Brazil, following PA policies...
July 19, 2017: BMC Health Services Research
https://www.readbyqxmd.com/read/28723415/pharmacology-of-human-trace-amine-associated-receptors-therapeutic-opportunities-and-challenges
#12
REVIEW
Mark D Berry, Raul R Gainetdinov, Marius C Hoener, Mohammed Shahid
The discovery in 2001 of a G protein-coupled receptor family, subsequently termed trace amine-associated receptors (TAAR), triggered a resurgence of interest in so-called trace amines. Initial optimism quickly faded, however, as the TAAR family presented a series of challenges preventing the use of standard medicinal chemistry and pharmacology technologies. Consequently the development of basic tools for probing TAAR and translating findings from model systems to humans has been problematic. Despite these challenges the last 5 years have seen considerable advances, in particular with respect to TAAR1, which appears to function as an endogenous rheostat, maintaining central neurotransmission within defined physiological limits, in part through receptor heterodimerization yielding biased signaling outputs...
July 16, 2017: Pharmacology & Therapeutics
https://www.readbyqxmd.com/read/28721951/recording-characteristics-of-electrical-impedance-myography-needle-electrodes
#13
Hyeuknam Kwon, Seward B Rutkove, Benjamin Sanchez
OBJECTIVE: The neurology and physiatry community need improved tools for the evaluation of skeletal muscle condition. Here, we evaluate needle electrical impedance myography (EIM), a new minimally invasive approach to determine muscle status that could ultimately become a bedside tool for the assessment of neuromuscular disorders. APPROACH: We design and study the recording characteristics of tetrapolar EIM needle electrodes combining theory and finite element model simulations...
July 19, 2017: Physiological Measurement
https://www.readbyqxmd.com/read/28721949/rising-to-the-challenge-applying-biofabrication-approaches-for-better-drug-and-chemical-product-development
#14
Anthony M Holmes, Alex Charlton, Brian Derby, Lorna Ewart, Andrew Scott, Wenmiao Shu
Many industrial sectors, from pharmaceuticals to consumer products, are required to provide data on their products to demonstrate their efficacy and that they are safe for patients, consumers and the environment. This period of testing typically requires the use of animal models, the validity of which has been called into question due to the high rates of attrition across many industries. There is increasing recognition of the limitations of animal models and demands for safety and efficacy testing paradigms which embrace the latest technological advances and knowledge of human biology...
July 19, 2017: Biofabrication
https://www.readbyqxmd.com/read/28721749/preservation-and-stability-of-cell-therapy-products-recommendations-from-an-expert-workshop
#15
Glyn N Stacey, Che J Connon, Karen Coopman, Alan J Dickson, Barry Fuller, Charles J Hunt, Paul Kemp, Julie Kerby, Jennifer Man, Paul Matejtschuk, Harry Moore, John Morris, Richard Oc Oreffo, Nigel Slater, Stephen Ward, Claire Wiggins, Heiko Zimmermann
If the field of regenerative medicine is to deliver therapies, rapid expansion and delivery over considerable distances to large numbers of patients is needed. This will demand efficient stabilization and shipment of cell products. However, cryopreservation science is poorly understood by life-scientists in general and in recent decades only limited progress has been made in the technology of preservation and storage of cells. Rapid translation of new developments to a broader range of cell types will be vital, as will assuring a deeper knowledge of the fundamental cell biology relating to successful preservation and recovery of cell cultures...
July 19, 2017: Regenerative Medicine
https://www.readbyqxmd.com/read/28720641/correction-to-implementation-of-technology-based-patient-engagement-strategies-within-practice-based-research-networks
#16
(no author information available yet)
In the above-mentioned article,(1) the electronic version differs from the print version due to the placement of the figures. While the figure headings for Figure 1 and 2 are correct, the figures themselves were flipped during the processing of the article. The electronic version on the Journal of the American Board of Family Medicine website has been corrected. We apologize for the error, and we regret any confusion or inconvenience it may have caused.
July 2017: Journal of the American Board of Family Medicine: JABFM
https://www.readbyqxmd.com/read/28720170/a-decade-of-health-technology-assessment-in-poland
#17
Iga Lipska, Neil McAuslane, Hubert Leufkens, Anke Hövels
OBJECTIVES: The objective of this study is to illustrate and provide a better understanding of the role of health technology assessment (HTA) processes in decision making for drug reimbursement in Poland and how this approach could be considered by other countries of limited resources. METHODS: We analyzed the evolution of the HTA system and processes in Poland over the past decade and current developments based on publicly available information. RESULTS: The role of HTA in drug-reimbursement process in Poland has increased substantially over the recent decade, starting in 2005 with the formation the Agency for Health Technology Assessment and Tariff System (AOTMiT)...
July 19, 2017: International Journal of Technology Assessment in Health Care
https://www.readbyqxmd.com/read/28720121/the-effectiveness-of-daily-sms-reminders-in-pharmaceutical-care-of-older-adults-on-improving-patients-adherence-to-antihypertensive-medication-sppa-study-protocol-for-a-randomized-controlled-trial
#18
Zuzana Haramiova, Michal Stasko, Martin Hulin, Tomas Tesar, Magdalena Kuzelova, Donald M Morisky
BACKGROUND: Despite a variety of efficient and cost-effective antihypertensive medication, hypertension remains a serious health and economic burden. High consumption of cardiovascular drugs in the Slovak Republic does result neither in better hypertension control nor in significant decrease in cardiovascular mortality. At the same time, Slovakia has alarmingly low patients' adherence to medication intake. Studies have shown the efficiency of short messaging service (SMS) reminders to improve patients' adherence and health outcomes at low costs...
July 18, 2017: Trials
https://www.readbyqxmd.com/read/28719907/tumor-heterogeneity-in-lymphomas-a-different-breed
#19
Christian M Schürch, Birgit Federmann, Leticia Quintanilla-Martinez, Falko Fend
The facts that cancer represents tissues consisting of heterogeneous neoplastic, as well as reactive, cell populations and that cancers of the same histotype may show profound differences in clinical behavior have long been recognized. With the advent of new technologies and the demands of precision medicine, the investigation of tumor heterogeneity has gained much interest. An understanding of intertumoral heterogeneity in patients with the same disease entity is necessary to optimally guide personalized treatment...
July 19, 2017: Pathobiology: Journal of Immunopathology, Molecular and Cellular Biology
https://www.readbyqxmd.com/read/28719188/phage-selection-of-cyclic-peptides-for-application-in-research-and-drug-development
#20
Kaycie Deyle, Xu-Dong Kong, Christian Heinis
Cyclic peptides can bind to protein targets with high affinities and selectivities, which makes them an attractive modality for the development of research reagents and therapeutics. Additional properties, including low inherent toxicity, efficient chemical synthesis, and facile modification with labels or immobilization reagents, increase their attractiveness. Cyclic peptide ligands against a wide range of protein targets have been isolated from natural sources such as bacteria, fungi, plants, and animals...
July 18, 2017: Accounts of Chemical Research
keyword
keyword
10769
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"