journal
MENU ▼
Read by QxMD icon Read
search

Genes

journal
https://www.readbyqxmd.com/read/30217084/correction-li-x-et-al-identification-and-characterization-of-the-wox-family-genes-in-five-solanaceae-species-reveal-their-conserved-roles-in-peptide-signaling-genes-2018-9-260
#1
Xiaoxu Li, Madiha Hamyat, Cheng Liu, Salman Ahmad, Xiaoming Gao, Cun Guo, Yuanying Wang, Yongfeng Guo
The authors wish to make the following change in their paper [...].
September 13, 2018: Genes
https://www.readbyqxmd.com/read/30213147/functional-evolution-of-avian-rig-i-like-receptors
#2
Wanjing Zheng, Yoko Satta
RIG-I-like receptors (retinoic acid-inducible gene-I-like receptors, or RLRs) are family of pattern-recognition receptors for RNA viruses, consisting of three members: retinoic acid-inducible gene I ( RIG-I ), melanoma differentiation-associated gene 5 ( MDA5 ) and laboratory of genetics and physiology 2 ( LGP2 ). To understand the role of RLRs in bird evolution, we performed molecular evolutionary analyses on the coding genes of avian RLRs using filtered predicted coding sequences from 62 bird species. Among the three RLRs, conservation score and dN/dS (ratio of nonsynonymous substitution rate over synonymous substitution rate) analyses indicate that avian MDA5 has the highest conservation level in the helicase domain but a lower level in the caspase recruitment domains (CARDs) region, which differs from mammals; LGP2 , as a whole gene, has a lower conservation level than RIG-I or MDA5 ...
September 12, 2018: Genes
https://www.readbyqxmd.com/read/30208654/correction-of-a-splicing-mutation-affecting-an-unverricht-lundborg-disease-patient-by-antisense-therapy
#3
Liliana Matos, Ana Joana Duarte, Diogo Ribeiro, João Chaves, Olga Amaral, Sandra Alves
Unverricht-Lundborg disease (ULD) is a common form of progressive myoclonic epilepsy caused by mutations in the cystatin B gene ( CSTB ) that encodes an inhibitor of several lysosomal cathepsins. Presently, only pharmacological treatment and psychosocial support are available for ULD patients. To overcome the pathogenic effect of the ULD splicing mutation c.66G>A (exon 1), we investigated whether an antisense oligonucleotide therapeutic strategy could correct the defect in patient cells. A specific locked nucleic acid (LNA) antisense oligonucleotide was designed to block a cryptic 5'ss in intron 1...
September 11, 2018: Genes
https://www.readbyqxmd.com/read/30208644/genetic-imbalances-in-argentinean-patients-with-congenital-conotruncal-heart-defects
#4
Marisol Delea, Lucía D Espeche, Carlos D Bruque, María Paz Bidondo, Lucía S Massara, Jaen Oliveri, Paloma Brun, Viviana R Cosentino, Celeste Martinoli, Norma Tolaba, Claudina Picon, María Eugenia Ponce Zaldua, Silvia Ávila, Viviana Gutnisky, Myriam Perez, Lilian Furforo, Noemí D Buzzalino, Rosa Liascovich, Boris Groisman, Mónica Rittler, Sandra Rozental, Pablo Barbero, Liliana Dain
Congenital conotruncal heart defects (CCHD) are a subset of serious congenital heart defects (CHD) of the cardiac outflow tracts or great arteries. Its frequency is estimated in 1/1000 live births, accounting for approximately 10⁻30% of all CHD cases. Chromosomal abnormalities and copy number variants (CNVs) contribute to the disease risk in patients with syndromic and/or non-syndromic forms. Although largely studied in several populations, their frequencies are barely reported for Latin American countries...
September 11, 2018: Genes
https://www.readbyqxmd.com/read/30205537/molecular-characterization-of-near-full-length-genomes-of-hepatitis-b-virus-isolated-from-predominantly-hiv-infected-individuals-in-botswana
#5
Motswedi Anderson, Wonderful Tatenda Choga, Sikhulile Moyo, Trevor Graham Bell, Tshepiso Mbangiwa, Bonolo Bonita Phinius, Lynnette Bhebhe, Theresa Kibirige Sebunya, Shahin Lockman, Richard Marlink, Anna Kramvis, Max Essex, Rosemary Mubanga Musonda, Jason Tory Blackard, Simani Gaseitsiwe
The World Health Organization plans to eliminate hepatitis B and C Infections by 2030. Therefore, there is a need to study and understand hepatitis B virus (HBV) epidemiology and viral evolution further, including evaluating occult (HBsAg-negative) HBV infection (OBI), given that such infections are frequently undiagnosed and rarely treated. We aimed to molecularly characterize HBV genomes from 108 individuals co-infected with human immunodeficiency virus (HIV) and chronic hepatitis B (CHB) or OBI identified from previous HIV studies conducted in Botswana from 2009 to 2012...
September 7, 2018: Genes
https://www.readbyqxmd.com/read/30205534/recent-selection-on-a-class-i-adh-locus-distinguishes-southwest-asian-populations-including-ashkenazi-jews
#6
Sheng Gu, Hui Li, Andrew J Pakstis, William C Speed, David Gurwitz, Judith R Kidd, Kenneth K Kidd
The derived human alcohol dehydrogenase (ADH)1B*48His allele of the ADH1B Arg48His polymorphism (rs1229984) has been identified as one component of an East Asian specific core haplotype that underwent recent positive selection. Our study has been extended to Southwest Asia and additional markers in East Asia. Fst values (Sewall Wright's fixation index) and long-range haplotype analyses identify a strong signature of selection not only in East Asian but also in Southwest Asian populations. However, except for the ADH2B*48His allele, different core haplotypes occur in Southwest Asia compared to East Asia and the extended haplotypes also differ...
September 7, 2018: Genes
https://www.readbyqxmd.com/read/30205517/genome-wide-identification-of-pifs-in-grapes-vitis-vinifera-l-and-their-transcriptional-analysis-under-lighting-shading-conditions
#7
Kekun Zhang, Ting Zheng, Xudong Zhu, Songtao Jiu, Zhongjie Liu, Le Guan, Haifeng Jia, Jinggui Fang
Phytochrome-interacting factors (PIFs), as the basic helix⁻loop⁻helix (bHLH) transcription factors, are the primary signaling partners for phytochromes (PHY) that play a key role in PHY-mediated light signal transduction. At present, there are few studies on PIFs in fruit trees. In order to clarify the status of PIFs in grapevines, we identified members of the grape PIFs family and conducted phylogenetic and expression analysis. We identified PIF1, PIF3, PIF4, and PIF7 in PIFs families of the grapevine ( Vitis vinifera L...
September 7, 2018: Genes
https://www.readbyqxmd.com/read/30205513/phosphorylation-dependent-inhibition-of-akt1
#8
Nileeka Balasuriya, McShane McKenna, Xuguang Liu, Shawn S C Li, Patrick O'Donoghue
Protein kinase B (Akt1) is a proto-oncogene that is overactive in most cancers. Akt1 activation requires phosphorylation at Thr308; phosphorylation at Ser473 further enhances catalytic activity. Akt1 activity is also regulated via interactions between the kinase domain and the N-terminal auto-inhibitory pleckstrin homology (PH) domain. As it was previously difficult to produce Akt1 in site-specific phosphorylated forms, the contribution of each activating phosphorylation site to auto-inhibition was unknown...
September 7, 2018: Genes
https://www.readbyqxmd.com/read/30205473/a-computational-method-for-classifying-different-human-tissues-with-quantitatively-tissue-specific-expressed-genes
#9
JiaRui Li, Lei Chen, Yu-Hang Zhang, XiangYin Kong, Tao Huang, Yu-Dong Cai
Tissue-specific gene expression has long been recognized as a crucial key for understanding tissue development and function. Efforts have been made in the past decade to identify tissue-specific expression profiles, such as the Human Proteome Atlas and FANTOM5. However, these studies mainly focused on "qualitatively tissue-specific expressed genes" which are highly enriched in one or a group of tissues but paid less attention to "quantitatively tissue-specific expressed genes", which are expressed in all or most tissues but with differential expression levels...
September 7, 2018: Genes
https://www.readbyqxmd.com/read/30205460/epigenetic-control-of-pancreatic-regeneration-in-diabetes
#10
REVIEW
Shruti Balaji, Tiziana Napolitano, Serena Silvano, Marika Elsa Friano, Anna Garrido-Utrilla, Josipa Atlija, Patrick Collombat
Both type 1 and type 2 diabetes are conditions that are associated with the loss of insulin-producing β-cells within the pancreas. An active research therefore aims at regenerating these β-cells with the hope that they could restore euglycemia. The approaches classically used consist in mimicking embryonic development, making use of diverse cell sources or converting pre-existing pancreatic cells. Despite impressive progresses and promising successes, it appears that we still need to gain further insight into the molecular mechanisms underlying β-cell development...
September 7, 2018: Genes
https://www.readbyqxmd.com/read/30205450/role-of-homologous-recombination-genes-in-repair-of-alkylation-base-damage-by-candida-albicans
#11
Toni Ciudad, Alberto Bellido, Encarnación Andaluz, Belén Hermosa, Germán Larriba
Candida albicans mutants deficient in homologous recombination (HR) are extremely sensitive to the alkylating agent methyl-methane-sulfonate (MMS). Here, we have investigated the role of HR genes in the protection and repair of C. albicans chromosomes by taking advantage of the heat-labile property (55 °C) of MMS-induced base damage. Acute MMS treatments of cycling cells caused chromosome fragmentation in vitro (55 °C) due to the generation of heat-dependent breaks (HDBs), but not in vivo (30 °C). Following removal of MMS wild type, cells regained the chromosome ladder regardless of whether they were transferred to yeast extract/peptone/dextrose (YPD) or to phosphate buffer saline (PBS); however, repair of HDB/chromosome restitution was faster in YPD, suggesting that it was accelerated by metabolic energy and further fueled by the subsequent overgrowth of survivors...
September 7, 2018: Genes
https://www.readbyqxmd.com/read/30200658/bioinformatics-analysis-of-snps-in-il-6-gene-promoter-of-jinghai-yellow-chickens
#12
Shijie Xin, Xiaohui Wang, Guojun Dai, Jingjing Zhang, Tingting An, Wenbin Zou, Genxi Zhang, Kaizhou Xie, Jinyu Wang
The proinflammatory cytokine, interleukin-6 (IL-6), plays a critical role in many chronic inflammatory diseases, particularly inflammatory bowel disease. To investigate the regulation of IL-6 gene expression at the molecular level, genomic DNA sequencing of Jinghai yellow chickens ( Gallus gallus ) was performed to detect single-nucleotide polymorphisms (SNPs) in the region -2200 base pairs (bp) upstream to 500 bp downstream of IL-6 . Transcription factor binding sites and CpG islands in the IL-6 promoter region were predicted using bioinformatics software...
September 6, 2018: Genes
https://www.readbyqxmd.com/read/30200636/metagenomic-composition-analysis-of-an-ancient-sequenced-polar-bear-jawbone-from-svalbard
#13
Diogo Pratas, Morteza Hosseini, Gonçalo Grilo, Armando J Pinho, Raquel M Silva, Tânia Caetano, João Carneiro, Filipe Pereira
The sequencing of ancient DNA samples provides a novel way to find, characterize, and distinguish exogenous genomes of endogenous targets. After sequencing, computational composition analysis enables filtering of undesired sources in the focal organism, with the purpose of improving the quality of assemblies and subsequent data analysis. More importantly, such analysis allows extinct and extant species to be identified without requiring a specific or new sequencing run. However, the identification of exogenous organisms is a complex task, given the nature and degradation of the samples, and the evident necessity of using efficient computational tools, which rely on algorithms that are both fast and highly sensitive...
September 6, 2018: Genes
https://www.readbyqxmd.com/read/30200629/can-genetic-factors-compromise-the-success-of-dental-implants-a-systematic-review-and-meta-analysis
#14
REVIEW
Joel Ferreira Santiago Junior, Claudia Cristina Biguetti, Mariza Akemi Matsumoto, Guilherme Abu Halawa Kudo, Raquel Barroso Parra da Silva, Patrícia Pinto Saraiva, Walid D Fakhouri
Dental implants provide a predictable treatment option for partial and complete edentulism via the placement of a fixed permanent artificial root to support prosthetic dental crowns. Despite the high survival rates, long-term dental implant failures are still reported, leading to implant removals and additional financial and health burdens. While extrinsic factors that improve the success rate of implants have been well explored, the impact of genetic factors on this matter is poorly understood. A systematic review and meta-analysis study was conducted to determine whether genetic factors contribute to an increased risk of dental implant failures...
September 6, 2018: Genes
https://www.readbyqxmd.com/read/30189656/global-long-noncoding-rna-and-mrna-expression-changes-between-prenatal-and-neonatal-lung-tissue-in-pigs
#15
Long Jin, Silu Hu, Teng Tu, Zhiqing Huang, Qianzi Tang, Jideng Ma, Xun Wang, Xuewei Li, Xuan Zhou, Surong Shuai, Mingzhou Li
Lung tissue plays an important role in the respiratory system of mammals after birth. Early lung development includes six key stages, of which the saccular stage spans the pre- and neonatal periods and prepares the distal lung for alveolarization and gas-exchange. However, little is known about the changes in gene expression between fetal and neonatal lungs. In this study, we performed transcriptomic analysis of messenger RNA (mRNA) and long noncoding RNA (lncRNA) expressed in the lung tissue of fetal and neonatal piglets...
September 5, 2018: Genes
https://www.readbyqxmd.com/read/30189613/complemented-palindromic-small-rnas-first-discovered-from-sars-coronavirus
#16
Chang Liu, Ze Chen, Yue Hu, Haishuo Ji, Deshui Yu, Wenyuan Shen, Siyu Li, Jishou Ruan, Wenjun Bu, Shan Gao
In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus...
September 5, 2018: Genes
https://www.readbyqxmd.com/read/30181517/the-drnf1-gene-from-the-drought-adapted-cyanobacterium-nostoc-flagelliforme-improved-salt-tolerance-in-transgenic-synechocystis-and-arabidopsis-plant
#17
Lijuan Cui, Yinghui Liu, Yiwen Yang, Shuifeng Ye, Hongyi Luo, Baosheng Qiu, Xiang Gao
Environmental abiotic stresses are limiting factors for less tolerant organisms, including soil plants. Abiotic stress tolerance-associated genes from prokaryotic organisms are supposed to have a bright prospect for transgenic application. The drought-adapted cyanobacterium Nostoc flagelliforme is arising as a valuable prokaryotic biotic resource for gene excavation. In this study, we evaluated the salt-tolerant function and application potential of a candidate gene drnf1 from N. flagelliforme , which contains a P-loop NTPase (nucleoside-triphosphatase) domain, through heterologous expression in two model organisms Synechocystis sp...
September 4, 2018: Genes
https://www.readbyqxmd.com/read/30177635/l-chromosome-behaviour-and-chromosomal-imprinting-in-sciara-coprophila
#18
REVIEW
Prim B Singh, Stepan N Belyakin
The retention of supernumerary chromosomes in the germ-line of Sciara coprophila is part of a highly-intricate pattern of chromosome behaviours that have fascinated cytogeneticists for over 80 years. Germ-line limited (termed L or "limited") chromosomes are cytologically heterochromatic and late-replicating, with more recent studies confirming they possess epigenetic hallmarks characteristic of constitutive heterochromatin. Little is known about their genetic constitution although they have been found to undergo cycles of condensation and de-condensation at different stages of development...
September 3, 2018: Genes
https://www.readbyqxmd.com/read/30200414/wnt-effector-tcf4-is-dispensable-for-wnt-signaling-in-human-cancer-cells
#19
Dusan Hrckulak, Lucie Janeckova, Lucie Lanikova, Vitezslav Kriz, Monika Horazna, Olga Babosova, Martina Vojtechova, Katerina Galuskova, Eva Sloncova, Vladimir Korinek
T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse models and cellular systems have been used to analyze TCF4 function. However, some findings were conflicting, especially those that were related to the defects observed in the mouse gastrointestinal tract after Tcf4 gene deletion, or to a potential tumor suppressive role of the gene in intestinal cancer cells or tumors...
September 1, 2018: Genes
https://www.readbyqxmd.com/read/30200369/human-vascular-endothelial-growth-factor-a-165-expression-induces-the-mouse-model-of-neovascular-age-related-macular-degeneration
#20
Emmi Kokki, Tommi Karttunen, Venla Olsson, Kati Kinnunen, Seppo Ylä-Herttuala
Vascular endothelial growth factor (VEGF) expression induces age-related macular degeneration (AMD), which is a common vision-threatening disease due to choroidal neovascularization and a fibrovascular membrane. We describe a mouse model of neovascular AMD with the local expression of human VEGF-A165 in the eye. We use a transgenic mouse in which human VEGF-A165 has been silenced with the loxP-STOP fragment. The choroidal neovascularization and human VEGF-A165 expression in the mouse are induced by subretinal adenoviral Cre gene delivery...
August 31, 2018: Genes
journal
journal
43397
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"