journal
MENU ▼
Read by QxMD icon Read
search

Osteoporosis International

journal
https://www.readbyqxmd.com/read/29147753/defective-wnt-signaling-associates-with-bone-marrow-fibrosis-a-cross-sectional-cohort-study-in-a-family-with-wnt1-osteoporosis
#1
R E Mäkitie, R Niinimäki, S Kakko, T Honkanen, P E Kovanen, O Mäkitie
This study explores bone marrow function in patients with defective WNT1 signaling. Bone marrow samples showed increased reticulin and altered granulopoiesis while overall hematopoiesis was normal. Findings did not associate with severity of osteoporosis. These observations provide new insight into the role of WNT signaling in bone marrow homeostasis. INTRODUCTION: WNT signaling regulates bone homeostasis and survival and self-renewal of hematopoietic stem cells. Aberrant activation may lead to osteoporosis and bone marrow pathology...
November 16, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29147752/interpretation-of-milk-research-results-response-to-comments-by-michaelsson-and-byberg
#2
LETTER
S Sahni, S S Soedamah-Muthu, C M Weaver
No abstract text is available yet for this article.
November 16, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29147751/interpretation-of-milk-research-results
#3
LETTER
K Michaëlsson, L Byberg
No abstract text is available yet for this article.
November 16, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29147750/the-association-between-childhood-fractures-and-adolescence-bone-outcomes-a-population-based-study-the-troms%C3%A3-study-fit-futures
#4
T Christoffersen, N Emaus, E Dennison, A-S Furberg, L Gracia-Marco, G Grimnes, O A Nilsen, D Vlachopoulos, A Winther, L A Ahmed
Childhood fracture may predict persistent skeletal fragility, but it may also reflect high physical activity which is beneficial to bone development. We observe a difference in the relationship between previous fracture and bone outcome across physical activity level and sex. Further elaboration on this variation is needed. PURPOSE: Childhood fracture may be an early marker of skeletal fragility, or increased levels of physical activity (PA), which are beneficial for bone mineral accrual...
November 16, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29147749/correction-to-characterization-of-trabecular-bone-microstructure-in-premenopausal-women-with-distal-radius-fractures
#5
T D Rozental, F Johannesdottir, K C Walley, M L Bouxsein
Owing to an oversight by the corresponding author, the name of the third author of this article was rendered wrongly. His correct name is Kempland C. Walley.
November 16, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29143131/vertebral-fractures-and-their-association-with-health-related-quality-of-life-back-pain-and-physical-function-in-older-women
#6
Lisa Johansson, Daniel Sundh, Martin Nilsson, Dan Mellström, Mattias Lorentzon
Studies investigating prevalent vertebral fracture (VF) diagnosed using densitometry-based VF assessment (VFA) and associations with physical function, assessed by performance-based measures, are lacking. In this population-based study of 1027 older women, we found that prevalent VF, identified by VFA, was associated with inferior physical health, back pain and inferior physical function. PURPOSE: Several studies have investigated the associations between health-related quality of life (HRQL) and back pain with prevalent VF, detected by spine radiographs, but just a few have been population-based and have used vertebral fracture assessment (VFA) for diagnosing VF...
November 15, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29143130/two-threshold-levels-of-vitamin-d-and-the-prevalence-of-comorbidities-in-outpatients-of-a-tertiary-hospital
#7
I N Furuie, M J J Mauro, S Petruzziello, S C Riechi, R R Petterle, C L Boguszewski, V Z C Borba
This study evaluated the number of comorbidities between two normal values of 25OHD in outpatients during 1 year of 25OHD measurements. Five hundred twenty-nine outpatients were included, patients with 25OHD ≥ 20 and < 30 ng/mL had the higher number of comorbidities, suggesting that for this specific population, 25OHD ≥ 30 ng/mL would be more appropriate. INTRODUCTION : This study evaluated the comorbidities between two values of 25OHD in outpatients of a tertiary hospital. METHODS: This is a cross-sectional study with measures of 25OHD in 1-year period, excluding 25OHD < 20 and > 50 ng/mL, clinical research participants, and liver disease and chronic renal failure patients...
November 15, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29134242/serum-parathyroid-hormone-is-associated-with-increased-cortical-porosity-of-the-inner-transitional-zone-at-the-proximal-femur-in-postmenopausal-women-the-troms%C3%A3-study
#8
M Osima, T T Borgen, M Lukic, G Grimnes, R M Joakimsen, E F Eriksen, Å Bjørnerem
Serum parathyroid hormone (PTH) was associated with increased bone turnover markers and cortical porosity of the inner transitional zone at the proximal femur. These results suggest that PTH through increased intracortical bone turnover leads to trabecularisation of inner cortical bone in postmenopausal women. INTRODUCTION: Vitamin D deficiency leads to secondary hyperparathyroidism and increased risk for fractures, whereas its association with cortical porosity is less clear. We tested (i) whether serum 25-hydroxyvitamin D (25(OH)D) and PTH were associated with cortical porosity and (ii) whether the associations of 25(OH)D) and PTH with fracture risk are dependent on cortical porosity...
November 14, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29134241/ct-based-evaluation-of-volumetric-bone-density-in-fragility-fractures-of-the-pelvis-a-matched-case-control-analysis
#9
D Schönenberg, R Guggenberger, D Frey, H-C Pape, H-P Simmen, G Osterhoff
This matched case-control study compared the computed tomography (CT)-based regional bone density of patients with fragility fractures of the sacrum to a control without fracture. Patients with a sacral fracture demonstrated a significantly lower regional bone density of the sacrum, the sacral bone density not being correlated with the BMD by DXA of the spine. INTRODUCTION: The aim of this study is to compare the computed tomography-based regional bone density measured by Hounsfield units (HUs) in patients with and without fragility fractures of the sacrum...
November 13, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29110063/the-effect-of-icariin-on-bone-metabolism-and-its-potential-clinical-application
#10
REVIEW
Z Wang, D Wang, D Yang, W Zhen, J Zhang, S Peng
Osteoporosis is a bone disease characterized by reduced bone mass, which leads to increased risk of bone fractures, and poses a significant risk to public health, especially in the elderly population. The traditional Chinese medicinal herb Epimedii has been utilized for centuries to treat bone fracture and bone loss. Icariin is a prenylated flavonol glycoside isolated from Epimedium herb, and has been shown to be the main bioactive component. This review provides a comprehensive survey of previous studies on icariin, including its structure and function, effect on bone metabolism, and potential for clinical application...
November 6, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29110062/osteoporosis-and-bone-mineral-density-in-patients-with-wilson-s-disease-a-systematic-review-and-meta-analysis
#11
REVIEW
J Chenbhanich, C Thongprayoon, A Atsawarungruangkit, T Phupitakphol, W Cheungpasitporn
This systematic review aims to assess the occurrence and risks of osteopenia and osteoporosis in patientswith Wilson's disease (WD). A literature search was conducted utilizing EMBASE and MEDLINE frominception through April 2017. Studies assessing the occurrence or risk of osteopenia and/or osteoporosis inWD patients were included. Effect estimates from the individual study were extracted and combined usingrandom-effect, generic inverse variance method of DerSimonian and Laird. Of 754 studies, four studies with283 WD patients met the eligibility criteria and were included in the data analysis...
November 6, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29110061/the-impact-of-gi-events-on-persistence-and-adherence-to-osteoporosis-treatment-3-6-and-12-month-findings-in-the-music-os-study
#12
A Modi, S Sen, J D Adachi, S Adami, B Cortet, A L Cooper, P Geusens, D Mellström, J P Weaver, J P van den Bergh, P Keown, S Sajjan
The goal of this multinational, prospective, observational study was to examine the relationship between gastrointestinal (GI) events and self-reported levels of medication adherence and persistence in postmenopausal women. A total of 73.9% of patients remained on their osteoporosis (OP) therapy at month 12, although the presence of a GI event at baseline, month 3, and month 6 significantly reduced month 12 persistence among new users. The odds of a month-12 ADEOS score ≥ 20 were significantly lower among patients who experienced a GI event between baseline and month 6...
November 6, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29101410/dietary-vitamin-c-intake-and-the-risk-of-hip-fracture-a-dose-response-meta-analysis
#13
Y Sun, C Liu, Y Bo, J You, Y Zhu, D Duan, H Cui, Q Lu
The meta-analysis suggested that dietary vitamin C was statistically inversely associated with the risk of hip fracture (overall OR = 0.73, 95% CI = 0.55-0.97, I (2) = 69.1%) and with the increase of 50 mg/day vitamin C intake, the risk of hip fracture will reduce by 5% (OR = 0.95, 95% CI 0.91-1.00, P = 0.05). INTRODUCTION: Previous studies had inconsistent findings regarding the association between vitamin C intake and the risk of hip fracture. Therefore, we conducted a meta-analysis to evaluate the association of dietary vitamin C intake and the risk of hip fracture...
November 3, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29101409/characterization-of-trabecular-bone-microstructure-in-premenopausal-women-with-distal-radius-fractures
#14
T D Rozental, F Johannesdottir, K C Kempland, M L Bouxsein
Individual trabecular segmentation was utilized to identify differences in trabecular bone structure in premenopausal women with wrist fractures and non-fracture controls. Fracture subjects had reduced trabecular plate volume, number, thickness, and connectivity. Identifying altered trabecular microarchitecture in young women offers opportunities for counseling and lifestyle modifications to reduce fracture risk. INTRODUCTION: Premenopausal women with distal radius fractures (DRF) have worse trabecular bone microarchitecture than non-fracture controls (CONT), yet the characteristics of their trabecular bone structure are unknown...
November 3, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29098348/self-reported-everyday-physical-activities-in-older-people-with-osteoporotic-vertebral-fractures-a-systematic-review-and-meta-analysis
#15
REVIEW
U A Al-Sari, J H Tobias, E M Clark
Previous work has shown that patients with vertebral fractures do less physical activity. However, the association between vertebral fracture and different components of physical activity is unclear. Our results suggest that vertebral fracture (VF) is associated with a reduction in activities involving bending, ambulation, and daily living, regardless of age. INTRODUCTION: The aim of this study was to determine whether osteoporotic VF is associated with reduced self-reported everyday routine physical activity and/or ability (PAA)...
November 3, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29098347/a-meta-analysis-of-the-association-between-body-mass-index-and-risk-of-vertebral-fracture
#16
A D Kaze, H N Rosen, J M Paik
We conducted a meta-analysis of prospective studies to assess the association between BMI and incident vertebral fracture. We found that as body mass index (BMI) increases, the risk of vertebral fracture decreases in men, but not in women, suggesting possible gender differences in the relationship of BMI with risk of vertebral fracture. INTRODUCTION: Recent evidence suggests that the relationship between BMI and fracture risk may be site-specific. We conducted a systematic review and meta-analysis of prospective studies to investigate the association between BMI and risk of incident vertebral fracture...
November 3, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29098346/correction-to-gene-mutation-spectrum-and-genotype-phenotype-correlation-in-a-cohort-of-chinese-osteogenesis-imperfecta-patients-revealed-by-targeted-next-generation-sequencing
#17
Y Liu, Asan, D Ma, F Lv, X Xu, J Wang, W Xia, Y Jiang, O Wang, X Xing, W Yu, J Wang, J Sun, L Song, Y Zhu, H Yang, J Wang, M Li
In Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).
November 2, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29098345/professor-judith-elizabeth-adams-leading-skeletal-radiologist-and-expert-in-adult-and-paediatric-bone-densitometry
#18
EDITORIAL
K A Ward, Z Mughal
No abstract text is available yet for this article.
November 2, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29090329/predictors-of-change-of-trabecular-bone-score-tbs-in-older-men-results-from-the-osteoporotic-fractures-in-men-mros-study
#19
J T Schousboe, T N Vo, L Langsetmo, B C Taylor, A M Kats, A V Schwartz, D C Bauer, J A Cauley, K E Ensrud
Among older men, characteristics that predict longitudinal changes in trabecular bone score (TBS) are different from characteristics that predict changes in bone mineral density (BMD). Most notably, weight loss is strongly associated with concomitant loss in BMD but with concomitant increases in TBS, when measured on Hologic densitometers. INTRODUCTION: Our objective was to compare and contrast predictors of changes in TBS, total hip BMD, and lumbar spine BMD. METHODS: Our study population was 3969 Osteoporotic Fractures in Men (MrOS) cohort participants (mean age 72...
October 31, 2017: Osteoporosis International
https://www.readbyqxmd.com/read/29085957/teriparatide-for-treatment-of-patients-with-bisphosphonate-associated-atypical-fracture-of-the-femur
#20
S L Greenspan, K Vujevich, C Britton, A Herradura, G Gruen, I Tarkin, P Siska, B Hamlin, S Perera
The Fracture Improvement with Teriparatide (Fix-IT) study randomized 13 women with an atypical femur fracture to immediate vs delayed teriparatide therapy; all were followed for 12 months. Results suggested a trend for superior healing and lesser bone mineral density declines in the immediate vs delayed group with no differences in adverse events. PURPOSE: Little clinical data are available on the use of teriparatide for the treatment of bisphosphonate-associated atypical femur fractures (AFF)...
October 30, 2017: Osteoporosis International
journal
journal
30592
1
2
Fetch more papers »
Fetching more papers... Fetching...
Read by QxMD. Sign in or create an account to discover new knowledge that matter to you.
Remove bar
Read by QxMD icon Read
×

Search Tips

Use Boolean operators: AND/OR

diabetic AND foot
diabetes OR diabetic

Exclude a word using the 'minus' sign

Virchow -triad

Use Parentheses

water AND (cup OR glass)

Add an asterisk (*) at end of a word to include word stems

Neuro* will search for Neurology, Neuroscientist, Neurological, and so on

Use quotes to search for an exact phrase

"primary prevention of cancer"
(heart or cardiac or cardio*) AND arrest -"American Heart Association"